ID: 1074924168

View in Genome Browser
Species Human (GRCh38)
Location 10:118049909-118049931
Sequence TACATACCATGTTACTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074924168_1074924171 6 Left 1074924168 10:118049909-118049931 CCCAAGAAGTAACATGGTATGTA No data
Right 1074924171 10:118049938-118049960 AGAGCTCTAGTCAGCAGCCTGGG No data
1074924168_1074924173 20 Left 1074924168 10:118049909-118049931 CCCAAGAAGTAACATGGTATGTA No data
Right 1074924173 10:118049952-118049974 CAGCCTGGGTCTTAATCCCAGGG No data
1074924168_1074924172 19 Left 1074924168 10:118049909-118049931 CCCAAGAAGTAACATGGTATGTA No data
Right 1074924172 10:118049951-118049973 GCAGCCTGGGTCTTAATCCCAGG No data
1074924168_1074924170 5 Left 1074924168 10:118049909-118049931 CCCAAGAAGTAACATGGTATGTA No data
Right 1074924170 10:118049937-118049959 AAGAGCTCTAGTCAGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074924168 Original CRISPR TACATACCATGTTACTTCTT GGG (reversed) Intergenic
No off target data available for this crispr