ID: 1074925045

View in Genome Browser
Species Human (GRCh38)
Location 10:118059959-118059981
Sequence CACCCTCGATGGGTGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074925045_1074925051 7 Left 1074925045 10:118059959-118059981 CCTTGAGCCACCCATCGAGGGTG No data
Right 1074925051 10:118059989-118060011 ATTGGGCGAGTGCTTTCGAGAGG No data
1074925045_1074925050 -10 Left 1074925045 10:118059959-118059981 CCTTGAGCCACCCATCGAGGGTG No data
Right 1074925050 10:118059972-118059994 ATCGAGGGTGAAGTAAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074925045 Original CRISPR CACCCTCGATGGGTGGCTCA AGG (reversed) Intergenic