ID: 1074927546

View in Genome Browser
Species Human (GRCh38)
Location 10:118088630-118088652
Sequence GTCTGAGATAAATCCAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074927542_1074927546 8 Left 1074927542 10:118088599-118088621 CCTTCTGGGCATTTTTGTGTGTT No data
Right 1074927546 10:118088630-118088652 GTCTGAGATAAATCCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074927546 Original CRISPR GTCTGAGATAAATCCAAGAG GGG Intergenic
No off target data available for this crispr