ID: 1074932176

View in Genome Browser
Species Human (GRCh38)
Location 10:118139538-118139560
Sequence CCACATAGTTGACAAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074932169_1074932176 21 Left 1074932169 10:118139494-118139516 CCTGTTCTAGTTCCTGGAGATGA No data
Right 1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG No data
1074932171_1074932176 -10 Left 1074932171 10:118139525-118139547 CCCACTTACAGTCCCACATAGTT No data
Right 1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG No data
1074932170_1074932176 9 Left 1074932170 10:118139506-118139528 CCTGGAGATGACTCATTTTCCCA No data
Right 1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074932176 Original CRISPR CCACATAGTTGACAAGGAAC TGG Intergenic
No off target data available for this crispr