ID: 1074937016

View in Genome Browser
Species Human (GRCh38)
Location 10:118191693-118191715
Sequence CCAGGATATATAGGTTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074937011_1074937016 -6 Left 1074937011 10:118191676-118191698 CCCTGAGAGATTAGTACCCAGGA No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data
1074937007_1074937016 6 Left 1074937007 10:118191664-118191686 CCCCTAAAAGGGCCCTGAGAGAT No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data
1074937009_1074937016 4 Left 1074937009 10:118191666-118191688 CCTAAAAGGGCCCTGAGAGATTA No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data
1074937004_1074937016 19 Left 1074937004 10:118191651-118191673 CCTTTAACTTCATCCCCTAAAAG No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data
1074937008_1074937016 5 Left 1074937008 10:118191665-118191687 CCCTAAAAGGGCCCTGAGAGATT No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data
1074937012_1074937016 -7 Left 1074937012 10:118191677-118191699 CCTGAGAGATTAGTACCCAGGAT No data
Right 1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074937016 Original CRISPR CCAGGATATATAGGTTTTGA TGG Intergenic