ID: 1074941668

View in Genome Browser
Species Human (GRCh38)
Location 10:118241865-118241887
Sequence CAGGGGAAAGATTCTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074941660_1074941668 10 Left 1074941660 10:118241832-118241854 CCCGGAGGACTTGCCTGGCATTA No data
Right 1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG No data
1074941657_1074941668 25 Left 1074941657 10:118241817-118241839 CCATGACTTCTACAACCCGGAGG No data
Right 1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG No data
1074941655_1074941668 30 Left 1074941655 10:118241812-118241834 CCTGGCCATGACTTCTACAACCC No data
Right 1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG No data
1074941661_1074941668 9 Left 1074941661 10:118241833-118241855 CCGGAGGACTTGCCTGGCATTAC No data
Right 1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG No data
1074941662_1074941668 -3 Left 1074941662 10:118241845-118241867 CCTGGCATTACCGAAAAGCACAG No data
Right 1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074941668 Original CRISPR CAGGGGAAAGATTCTGTGGC AGG Intergenic
No off target data available for this crispr