ID: 1074944892

View in Genome Browser
Species Human (GRCh38)
Location 10:118271761-118271783
Sequence CTGCCTCAGCAGAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074944892_1074944894 28 Left 1074944892 10:118271761-118271783 CCCTGCTGCTTCTGCTGAGGCAG No data
Right 1074944894 10:118271812-118271834 GAGAATAAAGCCAAAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074944892 Original CRISPR CTGCCTCAGCAGAAGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr