ID: 1074949170

View in Genome Browser
Species Human (GRCh38)
Location 10:118312177-118312199
Sequence CTTGAGCTGTCCGCATTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074949170_1074949177 28 Left 1074949170 10:118312177-118312199 CCCACCAATGCGGACAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1074949177 10:118312228-118312250 ATAAAAACGAAGTACCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074949170 Original CRISPR CTTGAGCTGTCCGCATTGGT GGG (reversed) Intronic
900424723 1:2571312-2571334 GTTGAGCTTTCTGCATTTGTGGG - Intergenic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
902720401 1:18300555-18300577 CTTGAGCTGCCCGCATACCTGGG + Intronic
911097841 1:94069722-94069744 CTTGGGCTATCTGAATTGGTTGG + Intronic
912798028 1:112704721-112704743 CTCGAGCTGTGGGCATTGCTGGG - Intronic
1072069881 10:91905939-91905961 CTAGAGCTGTCCACATTCCTTGG - Intergenic
1074949170 10:118312177-118312199 CTTGAGCTGTCCGCATTGGTGGG - Intronic
1075441351 10:122481592-122481614 CTTGGGCTCTCTGCAGTGGTTGG - Intronic
1091563409 12:1630715-1630737 CTTGATCTGTACGCAGGGGTTGG + Intronic
1100559903 12:95737797-95737819 CTTCAGCTTTGGGCATTGGTTGG - Intronic
1108915367 13:55604302-55604324 CTTGATCTGTCCGCCTCGGTCGG - Intergenic
1114449170 14:22813534-22813556 TTGGAGGTCTCCGCATTGGTTGG - Intronic
1114466474 14:22926598-22926620 CTTGAGCTGTGGTGATTGGTCGG - Intronic
1120759396 14:88272241-88272263 CGTGAGCTGTCCACATTATTAGG + Intronic
1123794501 15:23757882-23757904 CTTGAGTTAGCCGCTTTGGTGGG + Intergenic
1127430328 15:58900420-58900442 CTTGAGTAGTCCGGATTCGTAGG + Intronic
1129200305 15:73994701-73994723 CTTGAGCTGTCCGAAAGGGGAGG - Exonic
1143706187 17:8699075-8699097 CTTTAGCTGACCACAGTGGTGGG + Intergenic
1152901530 17:82943846-82943868 CTTGAACTGTCCCGATTGGCTGG + Exonic
1153557523 18:6331388-6331410 TTTGAGCTTTCTGCATTGCTGGG - Intronic
1168576534 19:57516229-57516251 CTTGAGCTGTCCCCATTTTATGG - Intronic
925409083 2:3628461-3628483 CCTGGGCTGTCCCCATTGGTGGG + Intronic
933099315 2:78231979-78232001 CTTGAGCTGGACTCACTGGTGGG - Intergenic
1168900739 20:1362654-1362676 CTGGAGCTGTGGGCATTTGTGGG + Intronic
1170270453 20:14521963-14521985 CCTAACCTGTCTGCATTGGTGGG - Intronic
1178689388 21:34738688-34738710 CTTGAGCTGCCCGCATCTGCTGG + Intergenic
963381051 3:144530794-144530816 CTTGAGCTATCTGCTCTGGTCGG - Intergenic
968727931 4:2256824-2256846 CTTAATCTGTCCCCATTGGGGGG + Intronic
969342717 4:6552403-6552425 CTGGAGGTGTCCGCATTCCTTGG + Intronic
976041940 4:80897640-80897662 CTGGAGCTGTCCACAGTGGTAGG - Intronic
983878287 4:172902736-172902758 CTTAAGCTTACCGCATAGGTGGG - Intronic
990236071 5:53769072-53769094 CTTGAGTTGTCAGCAGTGGCTGG + Intergenic
991302556 5:65143556-65143578 CAGGAGCTTTCCACATTGGTGGG + Intergenic
1001042972 5:168349953-168349975 GGTGAGCTGTCCGCATTTGGAGG - Intronic
1003545256 6:7052688-7052710 CTGGAGCTGGCCGCCTCGGTCGG - Intergenic
1010047958 6:71469628-71469650 GTTCAGCTGTCCTGATTGGTCGG + Intergenic
1018453023 6:163926662-163926684 CTTGAGCTGACAGCATTGTGAGG + Intergenic
1021806526 7:24362324-24362346 CTACAGCTGTCCACACTGGTGGG + Intergenic
1022522321 7:31016345-31016367 CTTGACCTGCCCCCATTGGCTGG + Intergenic
1024248798 7:47490873-47490895 CTGGGGCTGTGCGCATTGCTGGG - Intronic
1031987561 7:128173026-128173048 GTTGAGCTGACCAGATTGGTGGG + Intergenic
1032725262 7:134585152-134585174 CTTGAGCTGTCAGCATCTCTTGG - Intergenic
1037193060 8:16151234-16151256 CTTGAGAAGTCAGCATTGGAGGG - Intronic
1053190252 9:36059685-36059707 CTTGGGCTGTCCTCAGTGTTTGG + Intronic
1055505454 9:76943713-76943735 CTTGAGCTGTGAGCAGAGGTAGG - Intergenic
1059253607 9:112909150-112909172 CTAGAGATTTCCCCATTGGTAGG - Intergenic
1060728945 9:126024994-126025016 CCTGAGCTGTCCCCATTGGACGG - Intergenic
1062441468 9:136571584-136571606 CTTGAGCTGTCCACACGGGGAGG - Intergenic
1191100316 X:56719496-56719518 CTTCAGCTACCAGCATTGGTAGG - Intergenic