ID: 1074949495

View in Genome Browser
Species Human (GRCh38)
Location 10:118316810-118316832
Sequence TTAATAGTCATCATTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 825}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074949495_1074949500 18 Left 1074949495 10:118316810-118316832 CCTGTTTTAATGATGACTATTAA 0: 1
1: 0
2: 2
3: 48
4: 825
Right 1074949500 10:118316851-118316873 GATTACAGTATTCCAAAGGAGGG No data
1074949495_1074949499 17 Left 1074949495 10:118316810-118316832 CCTGTTTTAATGATGACTATTAA 0: 1
1: 0
2: 2
3: 48
4: 825
Right 1074949499 10:118316850-118316872 GGATTACAGTATTCCAAAGGAGG No data
1074949495_1074949498 14 Left 1074949495 10:118316810-118316832 CCTGTTTTAATGATGACTATTAA 0: 1
1: 0
2: 2
3: 48
4: 825
Right 1074949498 10:118316847-118316869 TGTGGATTACAGTATTCCAAAGG No data
1074949495_1074949497 -4 Left 1074949495 10:118316810-118316832 CCTGTTTTAATGATGACTATTAA 0: 1
1: 0
2: 2
3: 48
4: 825
Right 1074949497 10:118316829-118316851 TTAAGGCTTCAAATTATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074949495 Original CRISPR TTAATAGTCATCATTAAAAC AGG (reversed) Intronic
900037748 1:431629-431651 TTGATAATCACCATTAAGACTGG - Intergenic
900059380 1:667371-667393 TTGATAATCACCATTAAGACTGG - Intergenic
901165039 1:7214286-7214308 TTAATGGTCACCATTCTAACTGG + Intronic
901482391 1:9534290-9534312 TTAAAAGTCATACTTAAAATGGG - Intergenic
901567321 1:10128971-10128993 TTTATAGTCATGTTTAACACTGG + Intronic
902128040 1:14233862-14233884 TTAATAATCACCATTCTAACTGG - Intergenic
906245624 1:44271676-44271698 TTAATAGTAATAATAAAACCAGG - Intronic
906700312 1:47852873-47852895 TTTTTGGTCATCTTTAAAACAGG + Intronic
907373446 1:54017660-54017682 TAAATATTCATCCTTCAAACCGG + Intronic
908019263 1:59883000-59883022 TTAATGATCATCATTCTAACTGG + Intergenic
908058834 1:60324057-60324079 TTAATGATCACCATTATAACTGG + Intergenic
908313936 1:62914062-62914084 TAAATCCTCATCTTTAAAACAGG - Intergenic
908612490 1:65878194-65878216 TTAATGGTCACCATTCTAACTGG - Intronic
908904375 1:68991266-68991288 TTAATAATCACCATTCTAACTGG - Intergenic
908973079 1:69861930-69861952 TTAAAAGTTATCAGAAAAACAGG + Intronic
909300417 1:74006064-74006086 GGAATAGTGATCATTAAGACAGG + Intergenic
910575070 1:88752889-88752911 GTAATAGTAATCATTTAAATAGG - Intronic
910618357 1:89225418-89225440 TTAATGATCACCATTATAACTGG + Intergenic
910764365 1:90766102-90766124 TTAATAGTCACCATTCTGACTGG + Intergenic
910825254 1:91400132-91400154 TTAATACACCTCATTAAAATAGG + Intronic
911475194 1:98365477-98365499 TTAATGATCACCATTATAACTGG + Intergenic
911515525 1:98863906-98863928 TGAATAGTTATTATTAAAAAGGG - Intergenic
911758941 1:101594099-101594121 TTAATTCTCATTATTATAACTGG - Intergenic
911823955 1:102457295-102457317 TTAATGATCATCATTCTAACTGG - Intergenic
912076239 1:105879504-105879526 TTAATGATCATCATTCTAACTGG + Intergenic
912283988 1:108348595-108348617 TTAATAATCACCATTCTAACTGG + Intergenic
913316217 1:117555093-117555115 TTAATAATCACCATTCTAACTGG + Intergenic
913428454 1:118761454-118761476 TTAATGATCATCATTCTAACTGG - Intergenic
913649864 1:120902997-120903019 TTAATGATCATCATTCTAACTGG - Intergenic
914076818 1:144360513-144360535 TTAATGATCATCATTCTAACTGG + Intergenic
914102360 1:144605984-144606006 TTAATGATCATCATTCTAACTGG - Intergenic
914171268 1:145226090-145226112 TTAATGATCATCATTCTAACTGG + Intergenic
914296539 1:146331215-146331237 TTAATGATCATCATTCTAACTGG + Intergenic
914369981 1:147015949-147015971 TTAATGATCATCATTCTAACTGG - Intergenic
914484713 1:148097466-148097488 TTAATGATCATCATTCTAACTGG + Intergenic
914526378 1:148470063-148470085 TTAATGATCATCATTCTAACTGG + Intergenic
914640024 1:149597054-149597076 TTAATGATCATCATTCTAACTGG - Intergenic
915964260 1:160292749-160292771 TTAATAGGTATCATTAAATGAGG - Intronic
916141059 1:161698606-161698628 TTAATAATCACCATTCTAACTGG - Intergenic
916373105 1:164121644-164121666 TTAATGATCATCATTCTAACTGG + Intergenic
916436828 1:164785272-164785294 TTAAAAATCACCATTAAAAAAGG + Intronic
916635728 1:166666649-166666671 TTAATAATCACCATTCTAACTGG - Intergenic
916906483 1:169290973-169290995 TTAATGATCATCATTCTAACTGG - Intronic
916970504 1:170008583-170008605 TTAATGATCATCATTCTAACTGG - Intronic
916973951 1:170054306-170054328 TTAATAATCACCATTCTAACTGG - Intronic
917602170 1:176586970-176586992 TTAATAATCACCATTCTAACTGG + Intronic
917627490 1:176860934-176860956 CTTATAGTCATCATTCTAACTGG - Intronic
917800891 1:178569268-178569290 TTTATATTCATCATTGAAAGTGG + Intergenic
918020523 1:180683643-180683665 TTAATGATCATCATTCTAACTGG + Intronic
918089927 1:181281295-181281317 TTAATGATCATCATTCTAACTGG - Intergenic
918170608 1:181993586-181993608 TTAGTAGTAATCATTAAAAGGGG - Intergenic
918852680 1:189712320-189712342 TTAAAAGCCATCAACAAAACAGG + Intergenic
918938401 1:190955118-190955140 TTAAAAGACATCAATAAAAAAGG - Intergenic
919154740 1:193749338-193749360 TTAATAATCACCATTCTAACTGG - Intergenic
919333684 1:196205012-196205034 TTAATAATCACCATTCTAACTGG + Intergenic
921573753 1:216809364-216809386 CCAATTGTCATCATTAAAAATGG + Intronic
921639451 1:217534670-217534692 TTAATTGTCCTCTTTAAAGCTGG + Intronic
921962697 1:221052851-221052873 TTAATGATCATCATTTTAACTGG - Intergenic
922376006 1:224967203-224967225 TTAATTTTCATCCTTAAAAAAGG - Intronic
923943486 1:238855893-238855915 TTAATAGTCACCATTCTGACTGG - Intergenic
924918784 1:248603978-248604000 TTAATAATCACCATTCCAACTGG - Intergenic
1062762078 10:30974-30996 TTAATAATCACCATTCTAACTGG - Intergenic
1063324481 10:5083755-5083777 TTAATGATCACCATTCAAACTGG + Intronic
1063326951 10:5113395-5113417 TTAATGATCACCATTCAAACTGG - Intronic
1063329293 10:5140110-5140132 TTAATGATCATCATTCTAACTGG - Intergenic
1063350236 10:5347505-5347527 ATCATAATCAACATTAAAACTGG + Intergenic
1063707302 10:8442972-8442994 TTAACAGACATGTTTAAAACAGG + Intergenic
1063751189 10:8949140-8949162 CTAAATGTCATCACTAAAACAGG + Intergenic
1063859000 10:10288452-10288474 TTAATAATCACCATTCTAACTGG - Intergenic
1063972729 10:11392802-11392824 TTTAGAGTCACCATTAAGACAGG - Intergenic
1064575304 10:16739389-16739411 TTAATAATCACCATTCTAACTGG + Intronic
1064939710 10:20720182-20720204 TTAATGGTCACCATTCTAACTGG + Intergenic
1064968454 10:21038889-21038911 TTAATGATCACCATTCAAACTGG + Intronic
1065272557 10:24049985-24050007 TTAATAATCACCATTCTAACTGG + Intronic
1065409779 10:25412034-25412056 TTAAAAATCATCATTGAAAGTGG - Intronic
1066316903 10:34256945-34256967 TTAGTATTTTTCATTAAAACAGG - Intronic
1066578021 10:36847898-36847920 TTAATAATCACCATTCTAACTGG + Intergenic
1066621895 10:37364113-37364135 TTAATAGTAATTCTTAAAGCTGG + Intronic
1067264740 10:44730496-44730518 TTAATATTGTTCATTAAATCTGG + Intergenic
1068147187 10:53086998-53087020 TTAATAATCACCATTATGACTGG + Intergenic
1068493964 10:57761385-57761407 TAAAAATTCATCATTAAAATGGG - Intergenic
1068997511 10:63224518-63224540 TTAATAATCCTCTTTAAAATGGG - Intronic
1069153709 10:64998612-64998634 TCAATAGTCATCAGTAGAGCAGG + Intergenic
1070699675 10:78592333-78592355 ATAATAGTCAACAATAAAAAGGG - Intergenic
1071141442 10:82513860-82513882 TTAATAATCATCATTCTGACTGG + Intronic
1071340480 10:84642316-84642338 TTAATAATCGTCATTCTAACTGG - Intergenic
1071426007 10:85552432-85552454 TTTATAGTAATTATTAAAATTGG - Intergenic
1071762890 10:88629121-88629143 TTAATAATCACCATTCTAACTGG + Intergenic
1072314208 10:94186020-94186042 TTAACAGTCTTCCTTAAAACAGG + Intronic
1072743173 10:97922478-97922500 TAAACAGTCATCACTAAATCAGG - Intronic
1072861888 10:99014632-99014654 TTAATAATCGTCATTCTAACTGG + Intronic
1073021374 10:100447530-100447552 TTATTTGTCATCATTATAATAGG - Intergenic
1073624255 10:105080236-105080258 TTAATAATCATCATTCTGACTGG + Intronic
1073680428 10:105697678-105697700 TTATTTGCCAGCATTAAAACTGG - Intergenic
1073713202 10:106069500-106069522 TTAATAATCATCATTCTGACTGG + Intergenic
1073818089 10:107229672-107229694 TTAATAATCACCATTCTAACTGG - Intergenic
1073909706 10:108327392-108327414 TAAATATTGATCATTAAAAATGG + Intergenic
1073935669 10:108628467-108628489 TTAATAGTCATTATGAAGAATGG + Intergenic
1073941546 10:108704606-108704628 TAAATGGTCATTATTAAAAGGGG + Intergenic
1073949802 10:108794322-108794344 TTAATGGTCACCATTCTAACTGG + Intergenic
1074591800 10:114821293-114821315 TTATTATTCAACATTGAAACAGG - Intergenic
1074646202 10:115455948-115455970 TTAATGATCATCATTCTAACTGG - Intronic
1074949495 10:118316810-118316832 TTAATAGTCATCATTAAAACAGG - Intronic
1075804874 10:125179659-125179681 TTAATAATCACCATTCTAACTGG + Intergenic
1076281249 10:129248315-129248337 TGAAGAGTCATCATTTAATCTGG + Intergenic
1076294318 10:129372808-129372830 TGAACAGTCATCCTTTAAACTGG + Intergenic
1076964476 11:69553-69575 TTGATAATCACCATTAAGACTGG - Intergenic
1077945080 11:6888266-6888288 TTAATAATCACCATTATCACTGG + Intergenic
1078730976 11:13973716-13973738 TTAATTGTCATGATGACAACAGG + Intronic
1079683433 11:23326425-23326447 TTAATGATCACCATTATAACTGG - Intergenic
1079768759 11:24431294-24431316 TTTTTAATCTTCATTAAAACTGG + Intergenic
1079787111 11:24687411-24687433 TTAATCCTCATATTTAAAACAGG - Intronic
1079866034 11:25735341-25735363 TTCATAGTTGTCATTTAAACAGG + Intergenic
1079893702 11:26091988-26092010 CCAATAATCAACATTAAAACAGG - Intergenic
1080371954 11:31658992-31659014 ATAATATTCATCAATAAAAGAGG - Intronic
1080487855 11:32729704-32729726 TTAATAATCACCATTCTAACTGG + Intronic
1080530903 11:33175155-33175177 TTGATATTTATCATTAAAACTGG - Intergenic
1080910894 11:36597360-36597382 TTAATAGGCTACATAAAAACAGG + Intronic
1080962742 11:37179427-37179449 TTAATAGGCATAATTGAAATTGG + Intergenic
1081042951 11:38234622-38234644 TTAATGATCATCATTCTAACTGG - Intergenic
1081081123 11:38740424-38740446 TTAATAATCACCATTCTAACTGG + Intergenic
1081142633 11:39521438-39521460 TTAATGATCACCATTCAAACTGG - Intergenic
1081243658 11:40736691-40736713 TTAATGGTCATCATTTTAACTGG + Intronic
1081386232 11:42476820-42476842 TTAACATTCATCATTACACCTGG - Intergenic
1081390186 11:42520091-42520113 TTAATGATCATCATTCTAACTGG - Intergenic
1081424930 11:42915695-42915717 TTAATGATCATCATTCTAACTGG + Intergenic
1082119848 11:48367212-48367234 TTCATAGTCATCCTTAAATTGGG - Intergenic
1082152757 11:48762647-48762669 TTAATGATCACCATTATAACTGG + Intergenic
1082196500 11:49313028-49313050 TTAATGATCATCATTCTAACTGG - Intergenic
1082230763 11:49763103-49763125 TTAATAATCACCATTCTAACTGG + Intergenic
1082600050 11:55138149-55138171 TTAATGATCACCATTATAACTGG - Intergenic
1083368834 11:62162232-62162254 TTAATAATCACCATTCTAACTGG - Intergenic
1085857661 11:80193874-80193896 TTAAAAGTGATCATTGAAAGAGG + Intergenic
1086041231 11:82481742-82481764 TTAATAATCACCATTATGACTGG + Intergenic
1086115025 11:83240335-83240357 TTAATAGTTAGCCCTAAAACTGG + Intronic
1086119562 11:83291941-83291963 TAAAAAGTCACCATTTAAACTGG - Intergenic
1086219083 11:84419934-84419956 TTAATTGACATAATTAACACTGG - Intronic
1086310240 11:85527874-85527896 TTAATGGTCACCATTCTAACTGG + Intronic
1086528727 11:87759077-87759099 TTAATGGTCACCATTCTAACTGG + Intergenic
1086536860 11:87857541-87857563 TTAATGGTCACCATTCTAACTGG + Intergenic
1086659324 11:89395180-89395202 TTAATGATCATCATTCTAACTGG + Intronic
1086792512 11:91060380-91060402 TTAATAGTCACCATTCTGACTGG - Intergenic
1086806617 11:91251630-91251652 TTAATGATCATCATTCTAACTGG + Intergenic
1087089468 11:94253516-94253538 TTAATAATCATCATTCTAACTGG - Intergenic
1087174664 11:95085622-95085644 TTAATAGGCATAATTAGAAGGGG + Intergenic
1087200931 11:95343899-95343921 TTAATAATGCTCATTAAAACAGG + Intergenic
1087224316 11:95580815-95580837 TTAATGATCATCATTCTAACTGG + Intergenic
1087281723 11:96218341-96218363 TTAATTGTCATCTTTAATAGGGG + Intronic
1087383591 11:97440525-97440547 TTAATAGTCACTATTGTAACTGG - Intergenic
1087449443 11:98299942-98299964 TTAATAATAATCATTCTAACTGG - Intergenic
1087520688 11:99231326-99231348 TTAATAATCACCATTCTAACTGG + Intronic
1087553896 11:99689607-99689629 TTAATAATCACCATTCTAACTGG + Intronic
1087616708 11:100494131-100494153 TTAATGGTCACCATTCTAACTGG - Intergenic
1087668301 11:101075781-101075803 TTAATGGTCATCATTCTAACTGG - Intronic
1087954417 11:104267222-104267244 TTAATAATCACCATTCTAACTGG + Intergenic
1088150388 11:106738073-106738095 TTAATAATCACCATTCTAACTGG + Intronic
1088155174 11:106793814-106793836 TTGATAATCATCATTCTAACAGG - Intronic
1088226803 11:107629551-107629573 TTAAAAGTCATCATAAAAGATGG + Intronic
1088620824 11:111681588-111681610 TTAATGGTCATCATTGGAAGTGG + Intronic
1092102237 12:5894166-5894188 TTAATAATCACCATTCTAACTGG + Intronic
1092454529 12:8631323-8631345 TTAATAATCACCATTCTAACTGG - Intergenic
1092638044 12:10473340-10473362 TTAATGATCATCATTCTAACTGG + Intergenic
1092707078 12:11296835-11296857 TTAATAATCACCATTCTAACTGG - Intergenic
1092952380 12:13518563-13518585 TTAATAATCATCATTCTGACTGG + Intergenic
1092960646 12:13593987-13594009 TTAATAATCACCATTCTAACTGG - Intronic
1093076441 12:14763686-14763708 TTAATACTGACAATTAAAACAGG + Intergenic
1093357660 12:18188553-18188575 TTAATAATCAGCATTCTAACTGG - Intronic
1093599791 12:21008140-21008162 TTAATGATCATCATTCTAACTGG - Intergenic
1093630648 12:21404914-21404936 TTAATAATCACCATTATGACTGG + Intronic
1094055173 12:26261925-26261947 TTAATAATCATCATTCTGACTGG - Intronic
1094371767 12:29746347-29746369 TTATTATTCATCAATAATACAGG + Intronic
1094423155 12:30293606-30293628 TTAATAATCACCATTCTAACTGG - Intergenic
1094781585 12:33797524-33797546 TTAATGATCATCATTCTAACTGG + Intergenic
1094811803 12:34145892-34145914 TTAATAATCACCATTCTAACTGG - Intergenic
1095041355 12:37444583-37444605 TTAATAATCATCATTCTAACTGG - Intergenic
1095118262 12:38382301-38382323 TTAATAATCACCATTCTAACGGG + Intergenic
1095127623 12:38500747-38500769 TTAATAATCACCATTCTAACTGG - Intergenic
1095220102 12:39601399-39601421 ATAATATTCATAAATAAAACAGG + Intronic
1095567421 12:43641790-43641812 TTAATGATCATCATTCTAACTGG + Intergenic
1095675656 12:44914793-44914815 GTATTAGTCATCAGTAAAAATGG + Intronic
1095740390 12:45600466-45600488 TTAACAATCATCATTAATAACGG - Intergenic
1095757306 12:45783261-45783283 TTGATAGTCATAATTAAGGCTGG - Intronic
1095808463 12:46346487-46346509 TTAATGGTCACCATTCTAACTGG + Intergenic
1095827018 12:46540615-46540637 TTAATGGTCACCATTCTAACTGG + Intergenic
1095866169 12:46974469-46974491 TTAATAATCACCATTCTAACTGG + Intergenic
1096479911 12:51933065-51933087 TCAATATTCATTATTCAAACTGG + Intergenic
1096903128 12:54905831-54905853 TTAATGGTCACCATTCTAACTGG - Intergenic
1097141368 12:56904906-56904928 TTAATAATCACCATTCTAACTGG - Intergenic
1097198963 12:57261928-57261950 TTAAGTGGCATCATTAAACCTGG + Intronic
1097316696 12:58179207-58179229 TTAATAGACAATATTACAACAGG + Intergenic
1097701908 12:62828912-62828934 TTAATAGTAATCATTCTAATGGG - Intronic
1097846999 12:64377040-64377062 TTAATAATCACCATTCTAACTGG + Intronic
1098182687 12:67864598-67864620 TTAATAATCACCATTCTAACTGG + Intergenic
1098452927 12:70640748-70640770 TTAATGGTAATAATAAAAACTGG + Intronic
1098681233 12:73357597-73357619 TTAATAATCACCATTCTAACTGG - Intergenic
1099278640 12:80612749-80612771 TTATTAGTAATAATGAAAACTGG + Intronic
1099377475 12:81909509-81909531 TTAATGATCATCATTCTAACTGG - Intergenic
1099508233 12:83504670-83504692 TTAATGATCATCATTCTAACTGG - Intergenic
1099809404 12:87561669-87561691 TTAATAATCATCATTCTAACTGG - Intergenic
1099820735 12:87706127-87706149 TTAATGGTCACCATTTTAACTGG - Intergenic
1099839562 12:87948651-87948673 TTAATGGTCACCATTCTAACTGG - Intergenic
1100127916 12:91452895-91452917 TTAATGATCATCATTCTAACTGG + Intergenic
1100176040 12:92031962-92031984 TTAATGATCACCATTATAACTGG - Intronic
1101163322 12:102002178-102002200 CTAATATTCCTCATGAAAACGGG - Intronic
1102142754 12:110629556-110629578 TTAATAATCGTCATTCTAACTGG - Intronic
1102372950 12:112397937-112397959 TTAATGATCATCATTCTAACTGG - Intergenic
1102615547 12:114151128-114151150 TTAATGGTCACCATTCTAACTGG + Intergenic
1105477864 13:20744360-20744382 TTAATAATCACCATTCTAACTGG + Intronic
1106296070 13:28414949-28414971 TTAATATTCATCATTGCAAATGG - Intronic
1106495824 13:30273488-30273510 TTCATAGCCATCCTTAAAATAGG - Intronic
1106640470 13:31579339-31579361 TTAATGGTCACCATTCTAACTGG + Intergenic
1106851066 13:33792992-33793014 GTAATATTCATGATTAAAAATGG - Intergenic
1107132591 13:36912175-36912197 TTAATAGTTATCATGACTACGGG + Intronic
1108143565 13:47452404-47452426 TTAATAATCATCATTCTAACTGG - Intergenic
1108840112 13:54602862-54602884 TTAATGATCATCATTCTAACTGG - Intergenic
1108941040 13:55953093-55953115 TTAATAATCACCATTCTAACTGG - Intergenic
1108998726 13:56767816-56767838 TTAATGATCATCATTCTAACTGG + Intergenic
1109413340 13:62003474-62003496 TAAAGTTTCATCATTAAAACAGG + Intergenic
1109489591 13:63078703-63078725 TTTATAATAATCATTATAACAGG + Intergenic
1109512375 13:63396184-63396206 TTAAAATTCTGCATTAAAACTGG + Intergenic
1109608435 13:64730898-64730920 TTAATAATCACCATTCTAACTGG - Intergenic
1109626164 13:64977843-64977865 TTAATGATCATCATTCTAACTGG + Intergenic
1109852411 13:68083774-68083796 TTAATAGCCATTTTTAAAACTGG + Intergenic
1109933996 13:69257119-69257141 TTAATAGTCATCAGTGATATTGG - Intergenic
1110230570 13:73163243-73163265 GTTATGGTCATCATCAAAACAGG + Intergenic
1110230979 13:73166898-73166920 GTAATAGTCATCATTCATTCAGG - Intergenic
1110462599 13:75761961-75761983 TTAATAGTTATTTTTAAAATTGG + Intronic
1110563467 13:76934637-76934659 TTAATAGTAAACAATAAAATCGG - Intergenic
1110780802 13:79462256-79462278 TTAATAATCACCATTCTAACTGG + Intergenic
1111156486 13:84334398-84334420 TTGATAGTAGTCATTATAACTGG - Intergenic
1111348805 13:86999122-86999144 TCAATAATCATCATTCTAACTGG - Intergenic
1111481245 13:88829888-88829910 TTAATAGCCATTATTGACACAGG + Intergenic
1111646551 13:91038885-91038907 TTAATGATCACCATTCAAACTGG - Intergenic
1111774946 13:92649015-92649037 ATAATAGTCACCTTTAAAGCTGG + Intronic
1112023962 13:95395615-95395637 TTGATAGGCATCATTCAAAAAGG - Intergenic
1112755299 13:102625580-102625602 TTAATAGTGGTCATTCTAACTGG + Intronic
1113127204 13:106992604-106992626 TTAATAATCACCATTCTAACTGG - Intergenic
1114692062 14:24592910-24592932 TTAATGATCATCATTCTAACTGG + Intergenic
1114885853 14:26850180-26850202 TTAATAGTCACCATTCTGACTGG + Intergenic
1114913157 14:27226246-27226268 TTAATACTCATCTTTTAAATGGG - Intergenic
1115039654 14:28908454-28908476 TTAATGATCACCATTCAAACTGG - Intergenic
1115053011 14:29088161-29088183 TTAATAATGATCATTTTAACTGG - Intergenic
1115340492 14:32288451-32288473 TTAATAATCATCATTCTAACTGG + Intergenic
1116033119 14:39596877-39596899 TTAATAATCACCATTCTAACTGG - Intergenic
1116164558 14:41317581-41317603 TTATTATTCTTCATTAGAACTGG - Intergenic
1116188651 14:41634147-41634169 GTAATAGTTCTCAGTAAAACTGG + Intronic
1116614192 14:47112920-47112942 TTAATAATCATCATTCTGACTGG + Intronic
1117245199 14:53877952-53877974 TTAATGATCATCATTCTAACTGG - Intergenic
1117741836 14:58826770-58826792 TCAATAGTCATCATTAGTAGAGG - Intergenic
1118043796 14:61945198-61945220 TTAATAATCACCATTCTAACTGG - Intergenic
1118091122 14:62480345-62480367 TTAACAGTCAACATGAAAATAGG - Intergenic
1119057301 14:71435853-71435875 TTAATGGTCACCATTCTAACTGG + Intronic
1120067834 14:80065185-80065207 TTAATAGTAACCATTTTAACAGG - Intergenic
1120267329 14:82267762-82267784 TTGATAGTCATTGTTAAAAGTGG + Intergenic
1121003345 14:90468366-90468388 TTAATAGTCACCATTCTGACTGG + Intergenic
1121899468 14:97680164-97680186 TTAATGATCACCATTATAACTGG - Intergenic
1123148650 14:106159165-106159187 TTAATGGTCACCATTCTAACTGG + Intergenic
1123877133 15:24634608-24634630 TTAATGATCATCATTCTAACTGG + Intergenic
1124232923 15:27961262-27961284 TTAATGATCATCATTCTAACTGG - Intronic
1124402308 15:29359955-29359977 ATAATATTCTTCATTAAAAGAGG + Intronic
1124474276 15:30018579-30018601 TTAATAATCACCATTCTAACTGG + Intergenic
1125048885 15:35274705-35274727 TTAATAATCACCATTCTAACTGG - Intronic
1125467240 15:39966094-39966116 TTAACAGTCATCTTTCCAACTGG + Intronic
1125784106 15:42300415-42300437 TTAATAATCATCATTCTGACTGG - Intronic
1126162250 15:45624602-45624624 TTAATGATCATCATTCTAACTGG - Intronic
1126257437 15:46644177-46644199 TTAAAGGTAATCATGAAAACAGG + Intergenic
1126293418 15:47109116-47109138 TTAATCATCATCATTCTAACTGG + Intergenic
1126381762 15:48055687-48055709 TTAATGATCATCATTCTAACTGG - Intergenic
1126938857 15:53743629-53743651 TTAAAAATCAATATTAAAACCGG - Intronic
1127040314 15:54968256-54968278 TTAATGATCATCATTCTAACTGG + Intergenic
1127222821 15:56898473-56898495 TTAATAATCAGCATTATAACTGG - Intronic
1127329912 15:57928617-57928639 TTAATGATCACCATTCAAACTGG + Intergenic
1127664068 15:61127754-61127776 TCATTTGTCATCATTAACACGGG + Intronic
1129127275 15:73453432-73453454 TTAATGATCATCATTCTAACAGG - Intronic
1129356977 15:74997791-74997813 TGAATAGTCATCAGTAGGACAGG + Intronic
1129558339 15:76538029-76538051 TTAATGATCACCATTCAAACTGG - Intronic
1129563717 15:76598263-76598285 TTAATGGTCACCATTCTAACTGG - Intronic
1129571335 15:76688116-76688138 TTAATAATCACCATTCTAACTGG + Intronic
1129581867 15:76820052-76820074 TTAATGATCACCATTCAAACTGG - Intronic
1130349779 15:83080952-83080974 TTTAAAGTCATCATTAGAAGTGG - Intergenic
1130750312 15:86704596-86704618 TTAATAATCACCATTCTAACTGG - Intronic
1131220363 15:90578853-90578875 TTAAAAGTAATGATTACAACAGG + Intronic
1131647882 15:94365011-94365033 TAAAAAGTCATCATTAAAGGGGG + Intronic
1131946167 15:97624228-97624250 TTATAAGTCATCATTAAAAAAGG + Intergenic
1131946168 15:97624258-97624280 TTTAAAATCATCATTAAAACAGG + Intergenic
1132444075 15:101895634-101895656 TTGATAATCACCATTAAGACTGG + Intergenic
1133105378 16:3504880-3504902 TTATTAGTCATCTAGAAAACAGG + Intronic
1136603469 16:31313906-31313928 TTAATGATCATCATTTTAACTGG + Intronic
1136681573 16:31968462-31968484 TTAATGGTCACCATTCTAACTGG - Intergenic
1136781882 16:32909960-32909982 TTAATTGTCACCATTCTAACTGG - Intergenic
1136887913 16:33943888-33943910 TTAATGGTCACCATTCTAACTGG + Intergenic
1137525601 16:49233540-49233562 TTAATAATCACCATTCTAACTGG - Intergenic
1137915517 16:52425739-52425761 TTGAGAGTCCTAATTAAAACAGG + Intergenic
1138162510 16:54767841-54767863 TTAATAATCACCATTCTAACTGG + Intergenic
1138164001 16:54782887-54782909 TTAATAATCACCATTCTAACTGG - Intergenic
1138893346 16:61172480-61172502 TTAATAATAGTCATTATAACTGG - Intergenic
1138929549 16:61636011-61636033 TTAATGGTCAGCATTCTAACTGG - Intergenic
1139156298 16:64446939-64446961 TTTAAAGTCATGCTTAAAACTGG - Intergenic
1139258491 16:65567192-65567214 TTAAAATTTATCATTAAAAAAGG + Intergenic
1139263088 16:65613941-65613963 TTAATAGTAACCATTCTAACTGG + Intergenic
1139341121 16:66268644-66268666 TTAAAAATCATGATTTAAACAGG - Intergenic
1140620673 16:76727787-76727809 TAAATTTTCATCATTAAAAATGG + Intergenic
1141055390 16:80809025-80809047 GTAATAGTTGTCATTACAACAGG - Intergenic
1141568042 16:84916526-84916548 TTAAAAGGCATCATGATAACAGG - Intronic
1203084537 16_KI270728v1_random:1173950-1173972 TTAATTGTCACCATTCTAACTGG - Intergenic
1144277706 17:13690107-13690129 TTAATGATCATCATTCTAACTGG - Intergenic
1145417211 17:22727867-22727889 TTAATGGTCACCATTCTAACTGG + Intergenic
1146071990 17:29690626-29690648 TCAATAGCCAAAATTAAAACAGG + Intronic
1146092963 17:29900592-29900614 TTAATGATCATCATTCTAACTGG - Intronic
1146765628 17:35518661-35518683 TTAATAATCGTCATTCTAACTGG - Intronic
1147529450 17:41261632-41261654 TTAATAATCACCATTATGACTGG - Intergenic
1149235761 17:54588715-54588737 TTAATAATCACCATTCTAACTGG + Intergenic
1149365947 17:55944407-55944429 TTAATGATCATCATTCTAACTGG - Intergenic
1150189895 17:63227280-63227302 TTAATAATCACCATTCAGACTGG + Intronic
1150296977 17:64016129-64016151 TTTATAGTCATGAGTGAAACTGG - Intronic
1150604984 17:66683249-66683271 TTAATATCCATCATTTAAAAAGG - Intronic
1150880343 17:69018412-69018434 TTACTGGTCATCAATAAGACAGG - Exonic
1152372147 17:79895498-79895520 TTAATAGTAGTCATTTTAACAGG - Intergenic
1152954986 18:31304-31326 TTAATAATCACCATTCTAACTGG - Intergenic
1153717368 18:7863877-7863899 TTAATGGTCACCATTGTAACTGG + Intronic
1153754876 18:8271589-8271611 TTAAAAGTCACCTGTAAAACTGG + Intronic
1154230837 18:12554704-12554726 TTAATATTCATCAGTGATACTGG - Intronic
1154258956 18:12812103-12812125 TTAACTGTCATCATCAATACTGG + Intronic
1154320185 18:13343760-13343782 TTAATGATCATCATTCTAACTGG + Intronic
1155103252 18:22634896-22634918 TTAACAATCAGCACTAAAACTGG - Intergenic
1155253567 18:23974061-23974083 TTAATAATCACCATTCAGACTGG + Intergenic
1155604680 18:27591526-27591548 TTAATAGTCAACATTAACAATGG - Intergenic
1155658032 18:28213824-28213846 TTAATGGTCACCATTCTAACTGG + Intergenic
1155812481 18:30255133-30255155 TTAATAATCACCATTCTAACTGG - Intergenic
1155823134 18:30403592-30403614 TTAATAGCCAGCATTAACATTGG - Intergenic
1155858650 18:30867940-30867962 TTAATAATCACCATTTTAACTGG + Intergenic
1156871629 18:41952119-41952141 TTCTAAGCCATCATTAAAACTGG + Intergenic
1157050607 18:44159571-44159593 TAAGTAGACATCATTAGAACTGG + Intergenic
1157050767 18:44161491-44161513 TTAATGATCGTCATTCAAACTGG + Intergenic
1157170242 18:45397341-45397363 TTAATAGTAACCATTCTAACTGG + Intronic
1157886617 18:51373361-51373383 TTAATAATCATCATTCTAACTGG + Intergenic
1157988554 18:52467725-52467747 TTAATAATCTTCATTCTAACTGG + Intronic
1158085214 18:53643094-53643116 TTAATGATCATCATTCTAACTGG - Intergenic
1158356041 18:56620319-56620341 TCAATATTCATAATTGAAACTGG + Intronic
1158749638 18:60244250-60244272 TTAATAATCATCATTCTGACTGG - Intergenic
1159123702 18:64198851-64198873 TTAATGATCATCATTCTAACTGG + Intergenic
1159856489 18:73595891-73595913 TTAATAGTCACCATGGAAGCGGG - Intergenic
1159965696 18:74593882-74593904 TACATAGTCATCATCAAACCAGG + Intergenic
1160189677 18:76705152-76705174 TTAATAATCGCCATTATAACTGG + Intergenic
1160641279 19:139185-139207 TTGATAATCACCATTAAGACTGG - Intergenic
1162442222 19:10699970-10699992 GTAATTGTTATCATTACAACTGG - Intergenic
1163925144 19:20333914-20333936 TTTATAATCATCTTGAAAACTGG + Intergenic
1166085951 19:40475177-40475199 TTAATCATCAGCATTAAAACTGG + Intronic
1166462439 19:43000688-43000710 TTAATGGTCACCATTCTAACTGG + Intronic
1167615727 19:50531914-50531936 TTGATAATGATCATTAACACTGG + Intronic
925268509 2:2584427-2584449 TTAATAGTCACCATTCTGACTGG - Intergenic
926686247 2:15700090-15700112 TTAATAATCATCATTCTGACTGG + Intronic
927266009 2:21151770-21151792 TTAATAATCATCATTCTGACTGG + Intergenic
927820755 2:26262090-26262112 TTAATAGTCATGATAAAATAGGG - Intronic
928709556 2:33988984-33989006 TTAATGATCATCATTCTAACTGG - Intergenic
929289758 2:40176520-40176542 TAAATAGGCTTCATTAAAATAGG + Intronic
930298768 2:49588223-49588245 TTAATGATCATCATTCTAACTGG + Intergenic
931211558 2:60201580-60201602 TTAATAATCATCATTCTAACTGG + Intergenic
931362938 2:61593950-61593972 TTAATAATCACCATTCTAACTGG - Intergenic
931971731 2:67594355-67594377 TTAATGGTCATAATTCTAACTGG - Intergenic
932080720 2:68712192-68712214 TTAATAATCACCATTCTAACTGG + Intronic
932269263 2:70394993-70395015 TTAATAATCACCATTATGACTGG + Intergenic
932824658 2:74928278-74928300 TTATCAGTCATCAATAAAATGGG - Intergenic
933223569 2:79718865-79718887 TTAACTGTCCTTATTAAAACAGG - Intronic
933798420 2:85940444-85940466 TCAAAAGACATCATTTAAACTGG + Intergenic
934099426 2:88638715-88638737 TTTATAATCATCCTTAAAAAAGG + Intergenic
934836213 2:97591431-97591453 TTAATCATCATCACTAAAAGTGG + Intergenic
934923156 2:98362018-98362040 TTAATAATCACCATTATGACTGG + Intronic
935369470 2:102329802-102329824 TTAATAATCACCATTCTAACTGG - Intronic
936451719 2:112638842-112638864 TTTATAACCATCATTAAAAAGGG + Intergenic
936545591 2:113390006-113390028 TTAATCATCATCACTAAAAGTGG - Intergenic
937134027 2:119536878-119536900 TCAATAGTCCTCACTCAAACTGG + Intergenic
937740800 2:125350646-125350668 TTAATAATCAACATTCTAACTGG - Intergenic
938172905 2:129097745-129097767 TTAATAGTCTTCATTAAATTTGG + Intergenic
938822135 2:134969422-134969444 TTAATAGTAGTCATTTTAACTGG + Intronic
939224443 2:139347106-139347128 TTAATGATCATCATTCTAACTGG + Intergenic
939602033 2:144204456-144204478 TTAATGATCATCATTCTAACTGG - Intronic
940073342 2:149714048-149714070 TTAATAATCACCATTATGACTGG - Intergenic
940250288 2:151667937-151667959 TTATTTGACATCATTAAAAGAGG + Intronic
940318788 2:152351876-152351898 TTAATAATCACCATTCTAACTGG + Intronic
940401214 2:153250346-153250368 TTAATAATCACCATTCTAACTGG - Intergenic
940402523 2:153264250-153264272 TTAATAGTCGCCATTCAAACTGG - Intergenic
940560616 2:155291170-155291192 TTAATAATCACCATTCTAACTGG + Intergenic
941512052 2:166423892-166423914 TTAATCGTCAGCATTTCAACTGG - Intronic
941953510 2:171180511-171180533 TTAATAGTCATCAGTGTAAAAGG - Intronic
942090723 2:172488085-172488107 TTTACAATCCTCATTAAAACTGG + Intronic
942338933 2:174922384-174922406 TTCATAGTCATTTTTAAAATGGG + Intronic
942638670 2:178037334-178037356 TTAATAGTCACTATTCTAACTGG - Intronic
942733091 2:179080815-179080837 TTAATGATCATCATTCTAACTGG - Intergenic
943098841 2:183462018-183462040 TTAATGATCATCATTCTAACTGG + Intergenic
943136834 2:183924311-183924333 TTAATAATCATAATTCTAACTGG - Intergenic
943139986 2:183970280-183970302 TTAATGATCACCATTATAACTGG + Intergenic
943152495 2:184132378-184132400 TTAATAATAACCATTATAACTGG + Intergenic
943359136 2:186896756-186896778 TTAATGGTCACCATTCTAACTGG + Intergenic
943364493 2:186956536-186956558 TGAACAGTCATCACTAACACAGG + Intergenic
943382016 2:187162114-187162136 TTTATAGTCATAATTATAAGAGG + Intergenic
943403900 2:187454994-187455016 TTAATAGTAACCATTCTAACTGG - Intergenic
943632448 2:190269536-190269558 TTAATAATCACCATTCTAACTGG - Intronic
943945159 2:194051772-194051794 TTAATGATCATCATTCTAACTGG - Intergenic
944765268 2:202857933-202857955 TTAATGATCATCATTCTAACTGG - Intronic
945574102 2:211508439-211508461 TTAATAATCACCATTCTAACTGG - Intronic
945626389 2:212212240-212212262 TTAATAATCATTATTCTAACTGG + Intronic
945732030 2:213550866-213550888 TTCATAATCATGATTAAAAATGG - Intronic
945927907 2:215824774-215824796 TTAATGATCATCATTCTAACTGG - Intergenic
946589694 2:221231433-221231455 TGAAAAGTCATGATCAAAACAGG - Intergenic
946697562 2:222375039-222375061 TTAATAATCACCATTCTAACTGG + Intergenic
947902360 2:233731962-233731984 TTAATGGTCACCATTCTAACTGG + Intronic
948006506 2:234613533-234613555 ATAATATTAATCATTAAAACAGG + Intergenic
948181546 2:235985130-235985152 TTAATAATCACCATTCTAACTGG + Intronic
1169787849 20:9379454-9379476 TTAATTTTCATCATTACAATTGG + Intronic
1169828275 20:9793642-9793664 TTAATAATCATCATTCTGACTGG - Intronic
1169980185 20:11375993-11376015 TTAATAGACAATTTTAAAACAGG + Intergenic
1170157147 20:13279377-13279399 TTTTTAGTCATCAGTAAATCAGG + Intronic
1170489410 20:16857112-16857134 TTAAGAGTCATCACTAAGGCCGG - Intergenic
1171129384 20:22635124-22635146 TTACTATTCATCAGTAAAAATGG - Intergenic
1171535955 20:25889499-25889521 TTAATAATCATCATTCTAACTGG - Intergenic
1171571905 20:26260405-26260427 TTAATAATCATCATTCTAACTGG + Intergenic
1171805136 20:29671679-29671701 TTAATAATCATCATTCTAACTGG + Intergenic
1171838921 20:30184754-30184776 TTAATAATCATCATTCTAACTGG - Intergenic
1172467146 20:35164355-35164377 TTAATGATCATCATTCTAACTGG - Intergenic
1174808994 20:53629927-53629949 ATAATAGTCATGATGACAACTGG - Intergenic
1175495101 20:59408826-59408848 TTAATAGGCATCTTTAAAAATGG + Intergenic
1175558156 20:59889870-59889892 TTAATGATCATCATTCTAACTGG - Intronic
1176612843 21:9001533-9001555 TTAATGATCATCATTCTAACTGG - Intergenic
1176703031 21:10081201-10081223 ATAATATTCATCATTTAAACTGG - Intergenic
1176736795 21:10556719-10556741 TTAATAATCACCATTCTAACTGG + Intronic
1177349673 21:19920870-19920892 ATAATATTCATGATTAAACCAGG - Intergenic
1177425766 21:20921458-20921480 TTAATAATCGCCATTATAACTGG + Intergenic
1177449870 21:21252163-21252185 TTAATAATCACCATTCTAACTGG - Intronic
1177985776 21:27973028-27973050 TTAATAGTCGTCATTCTGACTGG + Intergenic
1178206661 21:30475321-30475343 TTAATAATCACCATTATGACTGG - Intergenic
1178456992 21:32764274-32764296 TTAATAATCATCTTTAAAGATGG + Intronic
1178901408 21:36602004-36602026 TCAATAATCATCTTTAAACCAGG + Intergenic
1179236398 21:39550933-39550955 TTAATAATCACCATTCTAACTGG + Intergenic
1179343466 21:40534095-40534117 TTAAAAGTCAAAATTTAAACAGG + Intronic
1179361145 21:40710017-40710039 TTAATGGTCACCATTCTAACTGG + Intronic
1179533578 21:42036865-42036887 TTAATAATCACCATTCTAACTGG - Intergenic
1180640445 22:17293974-17293996 TTAATGATCATCATTCTAACTGG + Intergenic
1182602816 22:31480273-31480295 TTAATAGTGATCACCAAAAGTGG - Intronic
1183008213 22:34921523-34921545 TTAATAATCATCATTCTGACTGG - Intergenic
1184144790 22:42603326-42603348 TTAAAAGCCATCATGAAACCAGG - Intronic
1184300811 22:43559325-43559347 TTAATAATCACCATTCTAACTGG - Intronic
949406989 3:3724692-3724714 TTAATAATCACCATTCTAACTGG - Intronic
949467055 3:4354783-4354805 CTAATAGTCATATTTATAACAGG + Intronic
949808603 3:7981811-7981833 TTAATAATCACCATTTTAACTGG + Intergenic
951019283 3:17765191-17765213 TTGTTAGCCATCATTAACACTGG - Intronic
951029573 3:17866542-17866564 TTAAAAGTAAACATGAAAACTGG - Intronic
951269843 3:20610544-20610566 TTAATAATCACCATTCTAACTGG - Intergenic
951398254 3:22198088-22198110 TTAATAATCAGGATTAAAAATGG + Intronic
951658145 3:25032182-25032204 ACAATAGCCATCATTAAAATTGG + Intergenic
951767903 3:26220628-26220650 TTAATGATCATCATTTTAACTGG + Intergenic
951798894 3:26573075-26573097 TTAATAATCACCATTCTAACTGG + Intergenic
951869044 3:27339821-27339843 TTAATAATCACCATTCTAACTGG - Intronic
952182262 3:30930241-30930263 TTAATAATCACCATTCTAACTGG - Intergenic
952272251 3:31844761-31844783 TTAATTGTCCTCTTTAAAAATGG + Intronic
952677042 3:36045053-36045075 TTAATGATCATCATTGTAACTGG + Intergenic
952747864 3:36798615-36798637 TTAATGATCATCATTCTAACTGG + Intergenic
953433888 3:42863323-42863345 TTAATGATCATCATTCTAACTGG - Intronic
953445853 3:42965734-42965756 TTAAAAGTAATGATAAAAACCGG - Intronic
954550353 3:51476099-51476121 GTAATTGGCATCATAAAAACTGG + Intronic
954769961 3:52958272-52958294 TTAATAATCATCATTCTGACTGG - Intronic
955288879 3:57672111-57672133 TGACTAGGCATCATTAAAATAGG + Intronic
955505512 3:59629154-59629176 TTAATAATCACCATTCTAACTGG - Intergenic
955853764 3:63250525-63250547 TTCTCAGACATCATTAAAACTGG - Intronic
955956858 3:64299244-64299266 TTAATATTCCTCATTAAATTTGG - Intronic
956206923 3:66764339-66764361 TTAATGATCATCATTCTAACTGG + Intergenic
956234449 3:67053075-67053097 TTAATAGTCGCCATTCTAACCGG + Intergenic
956320984 3:67996026-67996048 TGAATAGTGATAAATAAAACAGG + Intergenic
956372775 3:68581782-68581804 TTAATGATCATCATTCTAACTGG + Intergenic
957313266 3:78545875-78545897 TTACTTGTCCTCATTACAACAGG + Intergenic
957447492 3:80332999-80333021 TTAATAATAATCATTCTAACTGG + Intergenic
957537659 3:81527680-81527702 TTAATGATCACCATTCAAACTGG - Intronic
957596129 3:82269069-82269091 TTAATGATCATCATTCTAACTGG + Intergenic
957872044 3:86101651-86101673 TTAATAGTCACCATTCTGACTGG + Intergenic
957911350 3:86623165-86623187 TTAATTATCATCTTTATAACAGG + Intergenic
957917397 3:86703969-86703991 TTAATGATCATCATTCTAACTGG + Intergenic
958008926 3:87849921-87849943 TTAATGATCATCATTCTAACTGG - Intergenic
958043984 3:88260592-88260614 TTAATGATCATCATTCTAACTGG + Intergenic
958184686 3:90105662-90105684 TTAATGATCATCATTCTAACTGG + Intergenic
958467625 3:94477241-94477263 TTAATGATCATCATTTTAACTGG - Intergenic
958811406 3:98864167-98864189 TTAATAATCACCATTCTAACTGG - Intronic
958939907 3:100300020-100300042 TAAATACTCATGATTAAAAATGG - Intronic
959174722 3:102892595-102892617 TTAATAGTAGCCATTATAACTGG + Intergenic
959226343 3:103592091-103592113 TTAAAAGTCATCAATATAACAGG + Intergenic
959766786 3:110040423-110040445 TTAATAATCATCATTCTGACTGG + Intergenic
959775199 3:110151099-110151121 TTAATAATCATCATTCTGACTGG + Intergenic
959834176 3:110898861-110898883 TTAATAATCATCATTCTGACTGG + Intergenic
960430648 3:117564768-117564790 TTAATAGTCTCCATTCTAACTGG - Intergenic
960482664 3:118212402-118212424 TTAATAATCGTCATTCTAACTGG + Intergenic
960580315 3:119272652-119272674 TTAATAATCACCATTCTAACTGG - Intergenic
960757298 3:121029991-121030013 TTAATAATCACCATTGTAACTGG - Intronic
960762221 3:121084892-121084914 TTAATGGTCATCATTCTGACTGG + Intronic
960777000 3:121267870-121267892 TTAATAATCACCATTCTAACTGG - Intronic
962037003 3:131662776-131662798 TTAATAATCAACATTCTAACTGG - Intronic
962702806 3:138015569-138015591 TTAATAATCATAATTATCACTGG + Intronic
962734469 3:138313073-138313095 TTAATAGTCCCCATTCTAACTGG - Intronic
963175692 3:142295532-142295554 TTAATGATCATCATTCTAACTGG - Intergenic
963550969 3:146722244-146722266 TTAATAATCACCATTATGACTGG + Intergenic
964377495 3:156063592-156063614 TTAATGATCATCATTTTAACTGG + Intronic
964676418 3:159286751-159286773 TTAATAATGATCATTCAGACTGG + Intronic
964816693 3:160725592-160725614 TTAATAATCATCATTCTGACTGG - Intergenic
965022598 3:163252858-163252880 TTAATGGTCACCATTCTAACTGG - Intergenic
965288493 3:166846421-166846443 TTAATAATCACCATTCTAACTGG + Intergenic
965505550 3:169511013-169511035 TTGCTTGTCATCTTTAAAACAGG - Intronic
965519223 3:169656582-169656604 ATAATAGCCATGATTAAAATGGG - Intronic
966046680 3:175559861-175559883 TCAATATTCATCAGTAATACTGG + Intronic
966570728 3:181440326-181440348 TTAATAATCACCATTCTAACTGG - Intergenic
966573474 3:181473634-181473656 TTAATAATCACCATTCTAACTGG + Intergenic
967410762 3:189164699-189164721 TTAATCATCATCATCAAGACAGG + Intronic
967621526 3:191640109-191640131 TTAATAATCACCATTCAAACTGG + Intergenic
967813710 3:193781556-193781578 ATAATTGTCATTATTAAAGCTGG - Intergenic
969763160 4:9205813-9205835 TTAATAGTCACCATTCTGACGGG - Intergenic
970107439 4:12600916-12600938 TTAATAATCATCATTTTGACTGG - Intergenic
970586097 4:17515767-17515789 TTAATAGTCATAATTAATAGAGG - Intronic
970995423 4:22262122-22262144 TTAATAATCACCATTCTAACTGG - Intergenic
971270277 4:25137529-25137551 TTAATAATCACCATTATGACTGG - Intronic
971442209 4:26699326-26699348 TTAATGATCATCATTCTAACTGG - Intronic
971448021 4:26773142-26773164 TTAATAGTCACCATTCTGACTGG + Intergenic
971718819 4:30217483-30217505 TTAATTATCATAACTAAAACTGG - Intergenic
971824288 4:31600883-31600905 TTAATAATCACCATTCAAATAGG + Intergenic
972109375 4:35537857-35537879 TTAATATAGAACATTAAAACTGG - Intergenic
972692124 4:41409389-41409411 TTAATAGTCATCTCTACTACTGG - Intronic
972964852 4:44497074-44497096 TTAATGGTCACCATTCTAACTGG + Intergenic
973007407 4:45029916-45029938 TTAATGGTCACCATTTTAACTGG + Intergenic
973957099 4:56073283-56073305 TTAATGGTCACCATTCTAACTGG + Intergenic
974346207 4:60684979-60685001 TTAATGTTTATCATTAATACTGG + Intergenic
974363713 4:60917672-60917694 TTAATGATCATCATTCTAACTGG + Intergenic
974491139 4:62566609-62566631 TTAATGGTCACCATTCTAACTGG + Intergenic
975011793 4:69364522-69364544 TTAATAATCATCATTCTGACTGG + Intronic
975306246 4:72852196-72852218 TTAATGATCACCATTCAAACTGG - Intergenic
975389122 4:73796108-73796130 TTAATAATCACCATTCTAACTGG - Intergenic
975582185 4:75917145-75917167 TTAATAGTCATTTTTTAAATGGG - Intronic
975615666 4:76244419-76244441 TTAATGATCATCATTCTAACTGG + Intronic
975842759 4:78493117-78493139 TTAATAATCACCATTCTAACTGG - Intronic
975898229 4:79120510-79120532 TTAATGATCATCATTCTAACTGG - Intergenic
975920830 4:79384839-79384861 TTAACAGTTTTCATGAAAACTGG + Intergenic
976522221 4:86041783-86041805 TTAATAATCACCATTGTAACTGG - Intronic
976664361 4:87574212-87574234 TTAATGATCACCATTATAACTGG - Intergenic
976819316 4:89187052-89187074 TTAATAATCACCATTCTAACTGG + Intergenic
976821108 4:89207894-89207916 TTAATACTCATGATTCTAACTGG + Intergenic
976867413 4:89746617-89746639 TTAATAATCATCTTTACAAATGG + Intronic
977131867 4:93249808-93249830 TTAATAATCACCATTCTAACGGG - Intronic
977460290 4:97316964-97316986 GTAATTATCATCATTAAAATGGG - Intronic
977653943 4:99500539-99500561 TTATTAATCATAATCAAAACTGG + Intergenic
977835930 4:101646412-101646434 TTACTAATTATCATTGAAACAGG - Intronic
978743308 4:112163624-112163646 TTAATAATCGTCATTCTAACTGG - Intronic
978948089 4:114523228-114523250 TTAATAATCATCATTCTAACTGG + Intergenic
979184293 4:117769846-117769868 TTAATTATCAAAATTAAAACTGG + Intergenic
979709296 4:123759025-123759047 TTAATAGTTATAAACAAAACTGG - Intergenic
979712649 4:123798172-123798194 TTAATGATAATCATTATAACTGG + Intergenic
979767314 4:124477142-124477164 TTAACAGTCATAATTAAATTAGG + Intergenic
980316920 4:131213542-131213564 TTAAAAGTCATGATAAAAGCTGG + Intergenic
980375222 4:131937574-131937596 ATAATATCCATCATTTAAACTGG - Intergenic
980638496 4:135540347-135540369 TTAATGATCATCATTCTAACTGG + Intergenic
980703724 4:136464575-136464597 TTAATAATCACCATTCTAACTGG - Intergenic
980732716 4:136843459-136843481 TTAATGATCATCATTCTAACTGG + Intergenic
981141102 4:141270250-141270272 TTAATGATCATCATTCTAACTGG + Intergenic
981820173 4:148878801-148878823 TTAATAGAGTTCATTAATACAGG + Intergenic
981858386 4:149323654-149323676 TTAATAATCACCATTCTAACTGG + Intergenic
982384703 4:154787861-154787883 TTAATAGTCACCATTCTAACTGG + Intronic
982569929 4:157036064-157036086 TAAATCATCATCATTAAAAAGGG - Intergenic
982819680 4:159929745-159929767 TTAATGATCATCATTCTAACTGG + Intergenic
982895106 4:160910916-160910938 TTAATGATCATCATTCTAACTGG - Intergenic
983285169 4:165730344-165730366 TTAATAATCACCATTCTAACTGG + Intergenic
983361222 4:166725896-166725918 TTAATAATCATCATTCTGACTGG + Intergenic
983429550 4:167631258-167631280 TTAATGATCATCATTCTAACTGG - Intergenic
983744008 4:171171712-171171734 TTAATTTTCCTCAGTAAAACAGG + Intergenic
983831436 4:172332981-172333003 TTAATAATCACCATTCTAACTGG + Intronic
984003085 4:174274401-174274423 ATAATAGTTATCATTTAAAGAGG - Intronic
984197211 4:176672556-176672578 TCACTAGTGATCAATAAAACTGG + Intergenic
984438694 4:179737597-179737619 TTAATAGGCATCATTTAATGTGG + Intergenic
985867637 5:2527589-2527611 TTGATAGTAGTCATTATAACAGG - Intergenic
986185872 5:5437286-5437308 TTAAAACTCATCATTAAACATGG - Intronic
986359027 5:6957579-6957601 TTAATGATCATCATTCTAACTGG - Intergenic
986793596 5:11187915-11187937 TTAATAATCACCATTCTAACTGG - Intronic
986907076 5:12507933-12507955 TTCATAATCGTCATTCAAACTGG + Intergenic
987757701 5:22118204-22118226 TGAATAGCAATCATTAAAGCAGG - Intronic
987769560 5:22282704-22282726 TTAATGATCATCATTCTAACTGG - Intronic
987940736 5:24532401-24532423 TTCATTGTCATCAGTAACACTGG - Intronic
988022016 5:25632940-25632962 TTAATAATCACCATTCTAACTGG - Intergenic
988039211 5:25866958-25866980 AAAATAGTCAACATTAGAACAGG + Intergenic
988443795 5:31262330-31262352 CTTCTAGTCATCAATAAAACAGG + Intronic
988603373 5:32659555-32659577 TTAATAATCACCATTCTAACTGG + Intergenic
988699329 5:33657694-33657716 TTAATAAACATAAGTAAAACGGG + Intronic
988794640 5:34641363-34641385 TTAATGATCATCATTTTAACTGG + Intergenic
988916946 5:35903945-35903967 TTAATAGTCATTTTAAAGACTGG - Intergenic
988940743 5:36143426-36143448 TTAAAATGCATCATTAACACAGG + Intronic
989092425 5:37747331-37747353 TTAATAATCATCATTCTGACTGG - Intronic
989324949 5:40181480-40181502 TTAATAATCACCATTCTAACTGG - Intergenic
989672279 5:43932602-43932624 TTAATAATCACCATTCAAACTGG + Intergenic
990231860 5:53721433-53721455 TTAATAATCACCATTCTAACTGG - Intergenic
990267967 5:54098832-54098854 TTAGGAGTCCTCCTTAAAACTGG - Intronic
990888795 5:60625421-60625443 TTAATAATCACCATTCTAACTGG + Intronic
991149350 5:63348132-63348154 TTATGAGTCATCTTTAAAAGAGG - Intergenic
991199202 5:63971353-63971375 TTAATAATCATCATTCTGACTGG + Intergenic
991219374 5:64194682-64194704 TTAATGATCACCATTCAAACTGG + Intronic
991531872 5:67624377-67624399 TTAATTGTCATCTTTAATCCTGG + Intergenic
991628106 5:68625895-68625917 TTAATGGTCACCATTCTAACTGG - Intergenic
992038338 5:72803868-72803890 TTAATAATCACCATTCTAACTGG + Intergenic
992357125 5:75997654-75997676 TTAATAATCACCATTCTAACTGG - Intergenic
992603239 5:78426466-78426488 TTAATAATCACCATTTTAACTGG + Intronic
993019961 5:82579909-82579931 TTAATAATCATAATTCAGACTGG + Intergenic
993283771 5:85962274-85962296 TTATTAGACATGTTTAAAACCGG - Intergenic
993401831 5:87462862-87462884 TTAATAATAACCATTCAAACTGG + Intergenic
993615448 5:90105619-90105641 TTAATAATCACCATTCTAACTGG - Intergenic
993747545 5:91619940-91619962 TTAATGATCATCATTCTAACTGG - Intergenic
993948905 5:94149567-94149589 TTAATAATAGTCATTATAACTGG + Intergenic
994366724 5:98926431-98926453 TTTATATTCATCTTTTAAACTGG - Exonic
994450980 5:99943070-99943092 TTAGTACTCATCATTAAAGCAGG - Intergenic
994595769 5:101832385-101832407 TTAATTATCATCATTCTAACTGG + Intergenic
994866317 5:105276473-105276495 TTAATAGTAGTCATTAAAACTGG - Intergenic
994890834 5:105633798-105633820 TTAATATTCCTCTTTAAAATTGG + Intergenic
994978180 5:106838390-106838412 TTATTTATCATCATTATAACTGG + Intergenic
995363385 5:111325556-111325578 TTAATAATCACCATTCTAACTGG + Intronic
995419688 5:111950108-111950130 TTAATAATCACCATTCTAACTGG + Intronic
995485320 5:112634651-112634673 TTAGTAGTCATTATTTAAAATGG + Intergenic
995855669 5:116589676-116589698 TTAATGATCATCATTCTAACTGG - Intergenic
996073666 5:119163382-119163404 TTAATAGTCAACAATAGAGCTGG + Intronic
996225087 5:120983235-120983257 TTAATAATCATCATTCTAATTGG - Intergenic
996229827 5:121048769-121048791 TTAATAATCATCATTCTGACTGG - Intergenic
996286831 5:121804040-121804062 TTAATAATCACCATTCTAACTGG + Intergenic
996471653 5:123868042-123868064 TTATTTCTCATAATTAAAACTGG - Intergenic
997097919 5:130934508-130934530 TTAATAGTCACCATTCTGACTGG - Intergenic
997219066 5:132143769-132143791 CTAATAGTCATTTTAAAAACAGG - Intergenic
997601826 5:135144238-135144260 TTAATAATCACCATTCTAACTGG + Intronic
997636845 5:135415691-135415713 TTAATGATCACCATTCAAACTGG + Intergenic
997925970 5:138031933-138031955 TTAATAGTCTGCATTACTACTGG + Intronic
998052828 5:139050487-139050509 TCATTAGTCAGTATTAAAACAGG - Intronic
998731986 5:145089064-145089086 TTAATGATCATCATTCTAACTGG - Intergenic
998789367 5:145749427-145749449 TTAATAGTCACCATTCTGACTGG - Intronic
998923444 5:147096529-147096551 TTAATATTCATCTTTCACACTGG + Intergenic
999557280 5:152757412-152757434 TTAATAATCACCATTCTAACTGG - Intergenic
1000572474 5:162932188-162932210 TAAATAACCATCATTATAACTGG + Intergenic
1000708303 5:164538816-164538838 TTAATGATCGTCATTATAACCGG - Intergenic
1000720328 5:164698204-164698226 TTAATAATCATCATTCTGACTGG - Intergenic
1002736073 5:181387237-181387259 TTGATAATCACCATTAAGACTGG + Intergenic
1002748626 6:87587-87609 TTGATAATCACCATTAAGACTGG - Intergenic
1003104458 6:3204525-3204547 TTGATATTTATCATCAAAACTGG - Intergenic
1003475772 6:6481267-6481289 TTAATAGTCATGATTAAGTCTGG - Intergenic
1004242187 6:13934287-13934309 TGTATAGTCATCATAACAACAGG - Intronic
1004848184 6:19668966-19668988 TCATTAGTCATCCTAAAAACTGG + Intergenic
1005782286 6:29204391-29204413 TTAATGGTCACCATTCTAACTGG + Intergenic
1007134905 6:39511405-39511427 TTAATGGTCACCATTCTAACTGG - Intronic
1008971996 6:57379811-57379833 TAAACAGTATTCATTAAAACAGG + Intronic
1009160911 6:60281354-60281376 TAAACAGTATTCATTAAAACAGG + Intergenic
1009199273 6:60724162-60724184 TTAATACTCCTCATTAAAAAGGG + Intergenic
1009372329 6:62921541-62921563 TTTATAGTCAGCAAGAAAACAGG - Intergenic
1009459257 6:63893041-63893063 TTAATGATCATCATTCTAACTGG - Intronic
1009507188 6:64499139-64499161 TTAATGGTCACCATTCTAACTGG + Intronic
1009514976 6:64603678-64603700 TAGATGGTCATCATTCAAACTGG + Intronic
1009562356 6:65263519-65263541 TTAAAAGTCAGTTTTAAAACAGG + Intronic
1009570752 6:65380931-65380953 TTAATGATCATCATTCTAACTGG - Intronic
1009638409 6:66297752-66297774 TTAATATTCATAATTAAATATGG - Intergenic
1009705644 6:67248095-67248117 TTAATAAACATAATTAAAATAGG + Intergenic
1009801074 6:68537083-68537105 TTAATGATCATCATTCTAACTGG + Intergenic
1010295458 6:74191227-74191249 TTAATATTCATCAGGAATACTGG + Intergenic
1010464266 6:76148696-76148718 TTAATAATCACCATTCTAACTGG - Intergenic
1010915045 6:81605376-81605398 TTAATAATCACCATTCTAACTGG - Intronic
1011164934 6:84436247-84436269 TTAATAATCACCATTCTAACTGG - Intergenic
1011174496 6:84545088-84545110 TTAATGATCATCATTCTAACTGG - Intergenic
1011316276 6:86035229-86035251 TTAATGGTCACCATTCTAACTGG - Intergenic
1011761204 6:90567527-90567549 TTAATGGTCACCATTCTAACTGG - Intronic
1011831063 6:91372075-91372097 TTAATAATCACCATTCTAACTGG + Intergenic
1011932317 6:92729598-92729620 TTAATGATCATCATTCTAACTGG + Intergenic
1012020229 6:93908579-93908601 TTAATAATCACCATTCTAACTGG + Intergenic
1012287400 6:97408589-97408611 TTAATAATCACCATTCTAACTGG - Intergenic
1013085001 6:106849159-106849181 TTAATAGTGATCATAAGAAGAGG + Intergenic
1013274450 6:108570824-108570846 TTTATTGTCATCATTAGAAAAGG + Intronic
1013820588 6:114149044-114149066 TTAATAATCACCATTTTAACTGG - Intronic
1013933687 6:115568000-115568022 TTAATAATCATCATTCTGACTGG - Intergenic
1014123534 6:117752128-117752150 TTAATGATCACCATTCAAACTGG - Intergenic
1014353089 6:120368311-120368333 TTAATAATCACCATTCTAACTGG - Intergenic
1014881711 6:126731705-126731727 TTAATGATCATCATTCTAACTGG - Intergenic
1014914379 6:127127948-127127970 TTAAAACTCATCAATAAGACAGG - Intronic
1015260769 6:131235586-131235608 TTAATGGTCACCATTCTAACTGG + Intronic
1015447149 6:133319524-133319546 TTAAAAATAATCATTAAGACTGG - Intronic
1016451201 6:144184377-144184399 TTAATAGTCACCATTCTGACTGG + Intronic
1016674830 6:146751655-146751677 TTAATAATCATCATTCTGACTGG + Intronic
1017227026 6:152033607-152033629 TTAATAATCACCATTCTAACTGG - Intronic
1017371904 6:153721237-153721259 TTAATAATCACCATTCTAACTGG - Intergenic
1017372775 6:153732974-153732996 TTAATGATCATCATTCTAACTGG - Intergenic
1018005976 6:159622327-159622349 ATAATAATAATAATTAAAACAGG - Intergenic
1018408837 6:163519702-163519724 TTAATAGTAATCATTATAATTGG - Intronic
1018513241 6:164549614-164549636 TTAATAATCAGCATTCTAACTGG + Intergenic
1019241169 6:170662765-170662787 TTGATAATCACCATTAAGACTGG + Intergenic
1019679486 7:2337953-2337975 TTAATAGTTTTCATTATAACAGG - Intronic
1019941626 7:4296677-4296699 TTAATAATCACCATTCTAACTGG + Intergenic
1020649452 7:10856433-10856455 TTAATTGTAATCATTAAGGCTGG + Intergenic
1020681335 7:11240891-11240913 TTACTAGTCATCATTGATAATGG - Intergenic
1020843384 7:13250782-13250804 CTAATGGTCATCATTAAATTTGG + Intergenic
1021108375 7:16666004-16666026 TTACCAGTCATCATCAAAATGGG - Intronic
1021148744 7:17122774-17122796 TTAATAGTGGTCATGAAAAAGGG - Intergenic
1021151903 7:17161970-17161992 TTAATGATCATCATTCTAACTGG + Intergenic
1021391138 7:20094396-20094418 TTAATAATCACCATTATGACTGG - Intergenic
1021501817 7:21340026-21340048 TTAATAATCACCATTCTAACTGG + Intergenic
1022351238 7:29567255-29567277 TTAATAGTCCACACTAAAATAGG - Exonic
1022637687 7:32152571-32152593 TTGATAATCCTCATTAAAAGAGG - Intronic
1022661299 7:32369794-32369816 TTAATGATCATCATTCTAACTGG - Intergenic
1023069623 7:36416440-36416462 TGAATAGAAGTCATTAAAACAGG + Intronic
1023455518 7:40334429-40334451 TTAATGATCATCATTCTAACTGG + Intronic
1023482700 7:40651270-40651292 TTAATAATCACCATTCCAACTGG + Intronic
1023577765 7:41647619-41647641 GTAATATTCATTATTAAAACTGG + Intergenic
1023597886 7:41851937-41851959 CTAATAGTTCTCATTCAAACGGG - Intergenic
1024029897 7:45450908-45450930 TTATTAGTCCTCCCTAAAACTGG - Intergenic
1024190331 7:47000194-47000216 TTAGTAGGCATCTTTAAAAGAGG + Intergenic
1024518193 7:50279343-50279365 TTAATAATCACCATTCTAACTGG - Intergenic
1024713443 7:52045052-52045074 TTAATGATCATCATTCTAACTGG + Intergenic
1024895845 7:54260982-54261004 CTAATAGTCAGCAATAAAAAGGG - Intergenic
1025287421 7:57676195-57676217 TTAATAATCATCATTCTAACTGG - Intergenic
1028028075 7:85871900-85871922 TTAATAATCATCATTCTGACCGG - Intergenic
1028072241 7:86465168-86465190 TTAAGAGTCATCGTTACTACTGG - Intergenic
1028955336 7:96683347-96683369 TTAGTGATCATCATTCAAACTGG - Intronic
1029797100 7:102907877-102907899 TTAATGATCATCATTCTAACTGG - Intronic
1030186001 7:106762663-106762685 TTAATGATCATCATTCTAACTGG - Intergenic
1030241956 7:107337111-107337133 TTAATAGTAGTCATTCTAACTGG - Intronic
1030308244 7:108041209-108041231 TTAATAATCACCATTCAGACTGG - Intronic
1030350881 7:108484904-108484926 TTAATAATTTTCATTATAACTGG - Intronic
1030430450 7:109440213-109440235 TTAATAGTTATCTTTAAACATGG - Intergenic
1030851445 7:114491183-114491205 TTAATGATCATCATTCTAACTGG + Intronic
1030871673 7:114763876-114763898 TTAATAATCACCATTCTAACTGG - Intergenic
1031360130 7:120839450-120839472 TTAATTTTTATCATTAATACTGG - Intronic
1031404683 7:121370149-121370171 TTATTATGCATCAGTAAAACAGG + Intronic
1031481995 7:122289285-122289307 TTAATAATCACCATTCTAACTGG + Intergenic
1033485462 7:141785011-141785033 TGAATAGTAATCTTTAAAACTGG - Intronic
1033831048 7:145253233-145253255 TTGATAGTAATAAATAAAACTGG - Intergenic
1033831214 7:145255618-145255640 TTAATAATCATCATTCTGACTGG + Intergenic
1034378989 7:150672723-150672745 TTAATGATCATCATTCTAACTGG + Intergenic
1035506946 8:145330-145352 TTGATAATCACCATTAAGACTGG - Intergenic
1035712247 8:1727334-1727356 TTAATAATCATCAGTCTAACTGG - Intergenic
1035911857 8:3575907-3575929 TTAACATTCATAATTTAAACTGG + Intronic
1037306538 8:17510510-17510532 TTAATAGTCACCATTCTGACTGG + Intronic
1037557175 8:20036005-20036027 TTAATGATCACCATTATAACTGG + Intergenic
1038082822 8:24159219-24159241 TTAATGATCATCATTCTAACTGG + Intergenic
1038163482 8:25062563-25062585 TTAAAAGTAATAATTAAAAAGGG + Intergenic
1038468927 8:27794286-27794308 TTTATAGTAATCATTCTAACAGG + Intronic
1038786687 8:30623693-30623715 TTAATGATCATCATTCTAACTGG + Intronic
1039005400 8:33031059-33031081 TTAATAATCACCATTCTAACTGG - Intergenic
1039293371 8:36122604-36122626 TTAATAATCATCATTCTGACTGG + Intergenic
1039878037 8:41604186-41604208 TTCATAAAGATCATTAAAACTGG + Intronic
1040143680 8:43960337-43960359 TTAATGATCATCATTCTAACTGG - Intergenic
1040272383 8:45967565-45967587 TTAATGATCATCATTCTAACTGG - Intergenic
1040355435 8:46613343-46613365 TTAATAATCACCATTCTAACTGG - Intergenic
1040577222 8:48664037-48664059 TTTATAGTTTTCATTAAATCTGG + Intergenic
1041273973 8:56138597-56138619 TTAATAATCATCATTCTGACTGG + Intergenic
1041419986 8:57656053-57656075 ATATTATTCATCAATAAAACAGG - Intergenic
1042488350 8:69371218-69371240 TAAAAAGTCATCATTCAAAAAGG - Intergenic
1042721249 8:71828953-71828975 TGAATAGTCATGGTGAAAACAGG + Intronic
1042857694 8:73284914-73284936 TTCATAGACATCATAAAAACTGG - Intergenic
1043253405 8:78104196-78104218 TTAATAATCACCATTCTAACTGG + Intergenic
1043316425 8:78927895-78927917 TTAATGGTCACCATTCTAACTGG - Intergenic
1043598203 8:81908614-81908636 TTAATAATCACCATTCTAACTGG - Intergenic
1043621793 8:82202489-82202511 TTAATAATCAGCATTCTAACTGG - Intergenic
1043659214 8:82714511-82714533 TTAATAGTAGTCATTCTAACAGG + Intergenic
1044048293 8:87465472-87465494 TTAATGATCATCATTCTAACTGG - Intronic
1044177859 8:89152262-89152284 TTAATGGTCACCATTCTAACTGG - Intergenic
1044374456 8:91452886-91452908 TTAATGGTCTTCATTCTAACTGG + Intergenic
1044761575 8:95522980-95523002 GAAATAGTCATCTTGAAAACAGG - Intergenic
1044939771 8:97329883-97329905 TTAATGATCATCATTCTAACTGG + Intergenic
1045062275 8:98420702-98420724 TTAATGGGCATCATTAAATGAGG + Intronic
1046209365 8:111047459-111047481 TTAATAATAATCATTTTAACTGG - Intergenic
1046385118 8:113499154-113499176 TTAATAATCATCATTCTGACTGG + Intergenic
1046663487 8:116974500-116974522 TTAATGATCATCATTCTAACTGG - Intronic
1048485412 8:134843529-134843551 TTAATACTCCTCACTAAACCAGG - Intergenic
1048761186 8:137797210-137797232 GTAATAGTCATCTCTAAAACAGG - Intergenic
1050241531 9:3641229-3641251 TTAATAGTCACCATTCTAACTGG - Intergenic
1050396055 9:5197047-5197069 TTAATAATCATCATTTTGACTGG + Intergenic
1051326102 9:15970784-15970806 ATAATAGTCTTTATCAAAACAGG + Intronic
1051451190 9:17199521-17199543 TTAATAATCACCATTCTAACTGG + Intronic
1051926236 9:22330089-22330111 TTAATGATCATCATTCTAACTGG + Intergenic
1052203474 9:25810122-25810144 TTAATAATCACCATTTTAACTGG + Intergenic
1052243802 9:26308747-26308769 TTAATAGTTATCATTTACATAGG - Intergenic
1052407101 9:28075379-28075401 TTAATTATAATCATAAAAACTGG - Intronic
1052479756 9:29008604-29008626 TTAATGATCATCATTCTAACTGG + Intergenic
1052636355 9:31110683-31110705 ATTATAGTCAATATTAAAACTGG - Intergenic
1053376213 9:37608900-37608922 ATAATATTCATCTGTAAAACTGG - Intronic
1053554791 9:39124821-39124843 TTAATGATCATCATTCTAACTGG - Intronic
1053640286 9:40068238-40068260 ATAATATCCATCATTTAAACTGG - Intergenic
1053765849 9:41397239-41397261 ATAATATCCATCATTTAAACTGG + Intergenic
1053909026 9:42876561-42876583 TTAATGATCATCATTGTAACTGG + Intergenic
1054320983 9:63664242-63664264 ATAATATCCATCATTTAAACTGG - Intergenic
1054544461 9:66308396-66308418 ATAATATCCATCATTTAAACTGG + Intergenic
1055296097 9:74835111-74835133 TTAATAATCACCATTCTAACTGG + Intronic
1055509243 9:76978958-76978980 GTAATAATCATCTGTAAAACAGG - Intergenic
1055591213 9:77816293-77816315 TTAATAGTAATAATTTAATCTGG + Intronic
1055631248 9:78226164-78226186 TTGAATGTCATTATTAAAACTGG - Intergenic
1056124231 9:83519455-83519477 TTAATAATCACCATTCTAACTGG - Intronic
1056441355 9:86624796-86624818 TTAATAGGCAGCATAAACACTGG - Intergenic
1056669651 9:88615558-88615580 TTAATAATCATCATTCTGACTGG + Intergenic
1057997945 9:99836885-99836907 TTAATAATAATCATTCTAACTGG + Intronic
1058092736 9:100824112-100824134 TTAATAATCACCATTCTAACTGG + Intergenic
1059054534 9:110965585-110965607 TTAATAATCATCATTCTAACTGG - Intronic
1059880637 9:118685248-118685270 TTAATAGTCATCATAATAGATGG + Intergenic
1060019010 9:120112650-120112672 TTAATAATTATCATTATGACTGG - Intergenic
1060340453 9:122770956-122770978 TTAATAATCATCATTCTGACTGG - Intergenic
1061654411 9:132077992-132078014 TAAATAATCATCATTTAATCAGG - Intronic
1202788057 9_KI270719v1_random:51310-51332 ATAATATCCATCATTTAAACTGG - Intergenic
1203601360 Un_KI270748v1:11999-12021 TTGATAATCACCATTAAGACTGG + Intergenic
1186871106 X:13774168-13774190 TTCATTTTCATCATTGAAACTGG + Intronic
1186950768 X:14622039-14622061 TTAATGGTCACCATTCTAACTGG + Intronic
1187047126 X:15657990-15658012 TTAATAGTAATCATCTATACTGG + Intronic
1187603573 X:20859640-20859662 TTAATGATCACCATTAGAACTGG + Intergenic
1187813692 X:23208349-23208371 TTAATAATCACCATTATGACCGG - Intergenic
1188110681 X:26193490-26193512 TTCAGGATCATCATTAAAACTGG - Intronic
1188418461 X:29967329-29967351 TTCATAGTCATCTTCAAAATGGG + Intergenic
1188744360 X:33824438-33824460 TTAATAATCACCATTCTAACTGG + Intergenic
1189502041 X:41570364-41570386 ATAATAGGCAACATTAAAAATGG - Intronic
1190960938 X:55246861-55246883 TTAATAATCACCATTATGACTGG - Intronic
1191026734 X:55921928-55921950 TTAATAATCATCATTCTGACTGG - Intergenic
1191710385 X:64143952-64143974 TTAATGATCACCATTTAAACTGG - Intergenic
1191748024 X:64511389-64511411 TTAATGATCATCATTCTAACTGG + Intergenic
1191761190 X:64650393-64650415 TTAATGATCATCATTCTAACTGG - Intergenic
1191765184 X:64690644-64690666 TTAATGATCATCATTCTAACTGG + Intergenic
1191775984 X:64813831-64813853 TTAATGATCATCATTCTAACTGG - Intergenic
1192597684 X:72428647-72428669 TTAATTGTCATTTTTAAAAAGGG - Intronic
1192708211 X:73550392-73550414 TTAATAATCACCATTATAACTGG - Intergenic
1192842185 X:74868088-74868110 TTAATAGTCACCATTCTGACTGG - Intronic
1192881588 X:75290266-75290288 TTAATAATCACCATTCTAACGGG - Intronic
1192906017 X:75551439-75551461 TTAATAATCACCATTCTAACTGG - Intergenic
1192949293 X:75999446-75999468 TTAATAGTAGTCATTCTAACTGG + Intergenic
1192961230 X:76133230-76133252 TTAATAGTCACCATTCTGACTGG - Intergenic
1192978670 X:76315421-76315443 TTAATGGTCACCATTCTAACTGG + Intergenic
1193034875 X:76938499-76938521 TTAATGATCATCATTCTAACTGG + Intergenic
1193171858 X:78346578-78346600 TTAATACTCACCATTCTAACTGG - Intergenic
1193243469 X:79200733-79200755 TTAATGATCATCATTGTAACTGG - Intergenic
1193308668 X:79979265-79979287 TTAATACTCATCATAACAAGTGG + Intergenic
1193381661 X:80822900-80822922 TTAATAATCACCATTGTAACTGG + Intergenic
1193409807 X:81148941-81148963 TTAATGATCATCATTCTAACTGG - Intronic
1193504715 X:82328172-82328194 TTAATAATCATCATTTTGACTGG - Intergenic
1194005543 X:88487037-88487059 TTAATAATCACCATTCTAACTGG + Intergenic
1194029643 X:88796037-88796059 TTAATGATCATCATTCTAACTGG + Intergenic
1194031326 X:88819688-88819710 TTAATAGTCATCATTCTAACTGG - Intergenic
1194157302 X:90406617-90406639 TTAATAGTCACTCTTATAACAGG + Intergenic
1194288247 X:92037721-92037743 TTAATAATCATCATTCTGACTGG + Intronic
1194301324 X:92189742-92189764 TTAATAATCACCATTGTAACTGG + Intronic
1194554538 X:95340770-95340792 TTAATAATCATCATTCTGACTGG - Intergenic
1195126945 X:101817261-101817283 TTAATAATCACCATTCTAACTGG + Intergenic
1195436276 X:104846874-104846896 TTAATAGTCGCCATTCTAACTGG + Intronic
1195495595 X:105528981-105529003 TTAATTGTCCTCAATAAAGCTGG - Intronic
1195764793 X:108284760-108284782 TTGATAGTCATGATTAAAGAAGG + Intronic
1195821025 X:108945298-108945320 TTATTAGTGAGCTTTAAAACAGG - Intergenic
1196219769 X:113099146-113099168 TTAATAATCATCATTCTGACTGG + Intergenic
1196476114 X:116088880-116088902 TTAATAATCACCATTCTAACTGG + Intergenic
1196527813 X:116747861-116747883 TTAATGATCACCATTATAACTGG - Intergenic
1196643457 X:118090591-118090613 TTAATAATCACCATTCTAACTGG - Intronic
1196661134 X:118270065-118270087 TTGATAATAGTCATTAAAACTGG - Intergenic
1196962388 X:121017377-121017399 TTAAAAGTGAACACTAAAACAGG - Intergenic
1197060537 X:122174469-122174491 TTAATAATCACCATTCTAACTGG + Intergenic
1197430837 X:126361515-126361537 TTAATGATCATCATTCTAACTGG + Intergenic
1198298751 X:135312680-135312702 TTAATAGTAGCCATTCAAACTGG + Intronic
1198986992 X:142466235-142466257 TTAATGATCATCATTCTAACGGG - Intergenic
1199071001 X:143475631-143475653 TTAAAATGCATCATTTAAACTGG + Intergenic
1200503632 Y:3983610-3983632 TTAATAGTCACTCTTATAACAGG + Intergenic
1200605767 Y:5262275-5262297 TTAATAATCATCATTCTGACTGG + Intronic
1200712303 Y:6497588-6497610 TTAATAATCACCATTCTAACTGG + Intergenic
1200826994 Y:7656814-7656836 TTAATGATCATCATTCTAACTGG - Intergenic
1200893233 Y:8345823-8345845 TTAATGATCATCATTCTAACTGG - Intergenic
1201021613 Y:9664370-9664392 TTAATAATCACCATTCTAACTGG - Intergenic
1201069980 Y:10138452-10138474 TTAATAATCACCATTCTAACTGG + Intergenic
1201249943 Y:12047039-12047061 TTAATAATCAACATTCTAACTGG - Intergenic
1201292301 Y:12432772-12432794 TTAATAATCACCATTCAGACTGG + Intergenic
1201357067 Y:13108863-13108885 TTAATAATAATCATTTTAACTGG + Intergenic
1201537221 Y:15063780-15063802 TTAATAATCAACATTCTAACTGG + Intergenic
1201547874 Y:15185591-15185613 TTAATGATCATCATTGTAACTGG + Intergenic
1201560840 Y:15314874-15314896 TTAATGGTCGTCATTGTAACTGG - Intergenic
1201756955 Y:17496923-17496945 TTAATAATCACCATTCTAACTGG - Intergenic
1201778252 Y:17690029-17690051 TTAATAATCACCATTCTAACTGG + Intergenic
1201823304 Y:18215963-18215985 TTAATAATCACCATTCTAACTGG - Intergenic
1201844598 Y:18409061-18409083 TTAATAATCACCATTCTAACTGG + Intergenic
1201939152 Y:19440377-19440399 TTAATGGTCACCATTCTAACTGG - Intergenic
1201962523 Y:19697640-19697662 TTATTAGTTATCCTTAAAACAGG + Intergenic
1201993241 Y:20053213-20053235 TTAATGATCACCATTCAAACTGG + Intergenic
1202039993 Y:20672168-20672190 TTAATAATCAACCTTAAAAATGG - Intergenic
1202165930 Y:21987908-21987930 TTAATAGTCACCATTCTGACAGG + Intergenic
1202225428 Y:22598464-22598486 TTAATAGTCACCATTCTGACAGG - Intergenic
1202317685 Y:23597197-23597219 TTAATAGTCACCATTCTGACAGG + Intergenic
1202553081 Y:26072861-26072883 TTAATAGTCACCATTCTGACAGG - Intergenic