ID: 1074949500

View in Genome Browser
Species Human (GRCh38)
Location 10:118316851-118316873
Sequence GATTACAGTATTCCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074949495_1074949500 18 Left 1074949495 10:118316810-118316832 CCTGTTTTAATGATGACTATTAA 0: 1
1: 0
2: 2
3: 48
4: 825
Right 1074949500 10:118316851-118316873 GATTACAGTATTCCAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074949500 Original CRISPR GATTACAGTATTCCAAAGGA GGG Intronic
No off target data available for this crispr