ID: 1074957544

View in Genome Browser
Species Human (GRCh38)
Location 10:118407112-118407134
Sequence TCAGATTCCCTGTGGATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074957541_1074957544 4 Left 1074957541 10:118407085-118407107 CCCAAGTTTATATAAATCTTTGT No data
Right 1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG No data
1074957542_1074957544 3 Left 1074957542 10:118407086-118407108 CCAAGTTTATATAAATCTTTGTA No data
Right 1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074957544 Original CRISPR TCAGATTCCCTGTGGATATC AGG Intergenic
No off target data available for this crispr