ID: 1074957613

View in Genome Browser
Species Human (GRCh38)
Location 10:118407747-118407769
Sequence AAGTCGGTCAGCTGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074957613_1074957620 4 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957620 10:118407774-118407796 AGGCACGGGAGATCATGGCATGG No data
1074957613_1074957617 -10 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957617 10:118407760-118407782 TGACCGACTTCTGGAGGCACGGG No data
1074957613_1074957619 -1 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957619 10:118407769-118407791 TCTGGAGGCACGGGAGATCATGG No data
1074957613_1074957621 19 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957621 10:118407789-118407811 TGGCATGGTGATAAGCCAATTGG No data
1074957613_1074957623 30 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957623 10:118407800-118407822 TAAGCCAATTGGCCCATTTAGGG No data
1074957613_1074957622 29 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957622 10:118407799-118407821 ATAAGCCAATTGGCCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074957613 Original CRISPR AAGTCGGTCAGCTGACTCAG AGG (reversed) Intergenic
No off target data available for this crispr