ID: 1074957622

View in Genome Browser
Species Human (GRCh38)
Location 10:118407799-118407821
Sequence ATAAGCCAATTGGCCCATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074957618_1074957622 13 Left 1074957618 10:118407763-118407785 CCGACTTCTGGAGGCACGGGAGA No data
Right 1074957622 10:118407799-118407821 ATAAGCCAATTGGCCCATTTAGG No data
1074957613_1074957622 29 Left 1074957613 10:118407747-118407769 CCTCTGAGTCAGCTGACCGACTT No data
Right 1074957622 10:118407799-118407821 ATAAGCCAATTGGCCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074957622 Original CRISPR ATAAGCCAATTGGCCCATTT AGG Intergenic
No off target data available for this crispr