ID: 1074960418 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:118440128-118440150 |
Sequence | TCACCTGCCTTATTGATTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074960418_1074960422 | 15 | Left | 1074960418 | 10:118440128-118440150 | CCATGAATCAATAAGGCAGGTGA | No data | ||
Right | 1074960422 | 10:118440166-118440188 | TTGTATACAAATCCAGCCAATGG | No data | ||||
1074960418_1074960423 | 25 | Left | 1074960418 | 10:118440128-118440150 | CCATGAATCAATAAGGCAGGTGA | No data | ||
Right | 1074960423 | 10:118440176-118440198 | ATCCAGCCAATGGAAAAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074960418 | Original CRISPR | TCACCTGCCTTATTGATTCA TGG (reversed) | Intergenic | ||