ID: 1074960418

View in Genome Browser
Species Human (GRCh38)
Location 10:118440128-118440150
Sequence TCACCTGCCTTATTGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074960418_1074960422 15 Left 1074960418 10:118440128-118440150 CCATGAATCAATAAGGCAGGTGA No data
Right 1074960422 10:118440166-118440188 TTGTATACAAATCCAGCCAATGG No data
1074960418_1074960423 25 Left 1074960418 10:118440128-118440150 CCATGAATCAATAAGGCAGGTGA No data
Right 1074960423 10:118440176-118440198 ATCCAGCCAATGGAAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074960418 Original CRISPR TCACCTGCCTTATTGATTCA TGG (reversed) Intergenic