ID: 1074967116

View in Genome Browser
Species Human (GRCh38)
Location 10:118501172-118501194
Sequence GAGGCAGGAAGGCCAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074967116_1074967127 27 Left 1074967116 10:118501172-118501194 CCCTCACCTGGCCTTCCTGCCTC No data
Right 1074967127 10:118501222-118501244 TCACAGCCCTCCTGGAAGTGTGG No data
1074967116_1074967125 19 Left 1074967116 10:118501172-118501194 CCCTCACCTGGCCTTCCTGCCTC No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967116_1074967123 4 Left 1074967116 10:118501172-118501194 CCCTCACCTGGCCTTCCTGCCTC No data
Right 1074967123 10:118501199-118501221 GCTCTGCACATCCAGACCTTGGG No data
1074967116_1074967122 3 Left 1074967116 10:118501172-118501194 CCCTCACCTGGCCTTCCTGCCTC No data
Right 1074967122 10:118501198-118501220 TGCTCTGCACATCCAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074967116 Original CRISPR GAGGCAGGAAGGCCAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr