ID: 1074967120

View in Genome Browser
Species Human (GRCh38)
Location 10:118501187-118501209
Sequence ATGTGCAGAGCAGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074967120_1074967125 4 Left 1074967120 10:118501187-118501209 CCTGCCTCATCTGCTCTGCACAT No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967120_1074967127 12 Left 1074967120 10:118501187-118501209 CCTGCCTCATCTGCTCTGCACAT No data
Right 1074967127 10:118501222-118501244 TCACAGCCCTCCTGGAAGTGTGG No data
1074967120_1074967131 27 Left 1074967120 10:118501187-118501209 CCTGCCTCATCTGCTCTGCACAT No data
Right 1074967131 10:118501237-118501259 AAGTGTGGTCACAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074967120 Original CRISPR ATGTGCAGAGCAGATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr