ID: 1074967125

View in Genome Browser
Species Human (GRCh38)
Location 10:118501214-118501236
Sequence ACCTTGGGTCACAGCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074967119_1074967125 8 Left 1074967119 10:118501183-118501205 CCTTCCTGCCTCATCTGCTCTGC No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967120_1074967125 4 Left 1074967120 10:118501187-118501209 CCTGCCTCATCTGCTCTGCACAT No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967121_1074967125 0 Left 1074967121 10:118501191-118501213 CCTCATCTGCTCTGCACATCCAG No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967118_1074967125 13 Left 1074967118 10:118501178-118501200 CCTGGCCTTCCTGCCTCATCTGC No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967115_1074967125 26 Left 1074967115 10:118501165-118501187 CCTCTCACCCTCACCTGGCCTTC No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967116_1074967125 19 Left 1074967116 10:118501172-118501194 CCCTCACCTGGCCTTCCTGCCTC No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data
1074967117_1074967125 18 Left 1074967117 10:118501173-118501195 CCTCACCTGGCCTTCCTGCCTCA No data
Right 1074967125 10:118501214-118501236 ACCTTGGGTCACAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074967125 Original CRISPR ACCTTGGGTCACAGCCCTCC TGG Intergenic
No off target data available for this crispr