ID: 1074967131

View in Genome Browser
Species Human (GRCh38)
Location 10:118501237-118501259
Sequence AAGTGTGGTCACAGCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074967126_1074967131 -1 Left 1074967126 10:118501215-118501237 CCTTGGGTCACAGCCCTCCTGGA No data
Right 1074967131 10:118501237-118501259 AAGTGTGGTCACAGCCCTCCTGG No data
1074967121_1074967131 23 Left 1074967121 10:118501191-118501213 CCTCATCTGCTCTGCACATCCAG No data
Right 1074967131 10:118501237-118501259 AAGTGTGGTCACAGCCCTCCTGG No data
1074967124_1074967131 4 Left 1074967124 10:118501210-118501232 CCAGACCTTGGGTCACAGCCCTC No data
Right 1074967131 10:118501237-118501259 AAGTGTGGTCACAGCCCTCCTGG No data
1074967120_1074967131 27 Left 1074967120 10:118501187-118501209 CCTGCCTCATCTGCTCTGCACAT No data
Right 1074967131 10:118501237-118501259 AAGTGTGGTCACAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074967131 Original CRISPR AAGTGTGGTCACAGCCCTCC TGG Intergenic
No off target data available for this crispr