ID: 1074968270

View in Genome Browser
Species Human (GRCh38)
Location 10:118512857-118512879
Sequence AGAATGGCGTGAATCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074968266_1074968270 3 Left 1074968266 10:118512831-118512853 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG No data
1074968264_1074968270 4 Left 1074968264 10:118512830-118512852 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG No data
1074968262_1074968270 12 Left 1074968262 10:118512822-118512844 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074968270 Original CRISPR AGAATGGCGTGAATCCCAGG AGG Intergenic
No off target data available for this crispr