ID: 1074969454

View in Genome Browser
Species Human (GRCh38)
Location 10:118523814-118523836
Sequence CTGGATAAATTGGAGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074969454_1074969459 21 Left 1074969454 10:118523814-118523836 CCATACTCCTCCAATTTATCCAG No data
Right 1074969459 10:118523858-118523880 GAAACCCAACCTTCCCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074969454 Original CRISPR CTGGATAAATTGGAGGAGTA TGG (reversed) Intergenic
No off target data available for this crispr