ID: 1074969680

View in Genome Browser
Species Human (GRCh38)
Location 10:118525860-118525882
Sequence CTCTATTTCTGAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074969676_1074969680 28 Left 1074969676 10:118525809-118525831 CCAGTCTAAGGCATTTATTTATG No data
Right 1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG No data
1074969675_1074969680 29 Left 1074969675 10:118525808-118525830 CCCAGTCTAAGGCATTTATTTAT No data
Right 1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074969680 Original CRISPR CTCTATTTCTGAAGGGAAGA AGG Intergenic
No off target data available for this crispr