ID: 1074970403

View in Genome Browser
Species Human (GRCh38)
Location 10:118531695-118531717
Sequence CCAGGGCTATGATCCATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074970395_1074970403 21 Left 1074970395 10:118531651-118531673 CCTCGGATGGAGGGGGTGACGTC No data
Right 1074970403 10:118531695-118531717 CCAGGGCTATGATCCATTTATGG No data
1074970399_1074970403 -4 Left 1074970399 10:118531676-118531698 CCTAACTTATCAAAGGGAGCCAG No data
Right 1074970403 10:118531695-118531717 CCAGGGCTATGATCCATTTATGG No data
1074970398_1074970403 -3 Left 1074970398 10:118531675-118531697 CCCTAACTTATCAAAGGGAGCCA No data
Right 1074970403 10:118531695-118531717 CCAGGGCTATGATCCATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074970403 Original CRISPR CCAGGGCTATGATCCATTTA TGG Intergenic
No off target data available for this crispr