ID: 1074981954

View in Genome Browser
Species Human (GRCh38)
Location 10:118627006-118627028
Sequence GGGCCCCATTGACCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074981954_1074981960 7 Left 1074981954 10:118627006-118627028 CCAGCTGGAGGTCAATGGGGCCC No data
Right 1074981960 10:118627036-118627058 TCCCCCTGGCTATAGCAAGAAGG No data
1074981954_1074981966 25 Left 1074981954 10:118627006-118627028 CCAGCTGGAGGTCAATGGGGCCC No data
Right 1074981966 10:118627054-118627076 GAAGGAATTTCTGAGCCACAGGG No data
1074981954_1074981965 24 Left 1074981954 10:118627006-118627028 CCAGCTGGAGGTCAATGGGGCCC No data
Right 1074981965 10:118627053-118627075 AGAAGGAATTTCTGAGCCACAGG No data
1074981954_1074981955 -7 Left 1074981954 10:118627006-118627028 CCAGCTGGAGGTCAATGGGGCCC No data
Right 1074981955 10:118627022-118627044 GGGGCCCTGCTCCCTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074981954 Original CRISPR GGGCCCCATTGACCTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr