ID: 1074981959

View in Genome Browser
Species Human (GRCh38)
Location 10:118627034-118627056
Sequence TTCTTGCTATAGCCAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074981959_1074981965 -4 Left 1074981959 10:118627034-118627056 CCTCCCCCTGGCTATAGCAAGAA No data
Right 1074981965 10:118627053-118627075 AGAAGGAATTTCTGAGCCACAGG No data
1074981959_1074981966 -3 Left 1074981959 10:118627034-118627056 CCTCCCCCTGGCTATAGCAAGAA No data
Right 1074981966 10:118627054-118627076 GAAGGAATTTCTGAGCCACAGGG No data
1074981959_1074981967 10 Left 1074981959 10:118627034-118627056 CCTCCCCCTGGCTATAGCAAGAA No data
Right 1074981967 10:118627067-118627089 AGCCACAGGGCCACTGAGAGAGG No data
1074981959_1074981969 16 Left 1074981959 10:118627034-118627056 CCTCCCCCTGGCTATAGCAAGAA No data
Right 1074981969 10:118627073-118627095 AGGGCCACTGAGAGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074981959 Original CRISPR TTCTTGCTATAGCCAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr