ID: 1074982491

View in Genome Browser
Species Human (GRCh38)
Location 10:118630881-118630903
Sequence CTCTAAGAGAACCCTAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074982491_1074982494 -7 Left 1074982491 10:118630881-118630903 CCTGTATTAGGGTTCTCTTAGAG No data
Right 1074982494 10:118630897-118630919 CTTAGAGGGACAGAACTAATAGG 0: 85
1: 196
2: 890
3: 1259
4: 1051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074982491 Original CRISPR CTCTAAGAGAACCCTAATAC AGG (reversed) Intergenic
No off target data available for this crispr