ID: 1074984123

View in Genome Browser
Species Human (GRCh38)
Location 10:118642251-118642273
Sequence CCTCAGAGGGAGACAGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074984116_1074984123 13 Left 1074984116 10:118642215-118642237 CCACTGCTAAGAGGAAGGGAGAT 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG No data
1074984112_1074984123 22 Left 1074984112 10:118642206-118642228 CCTTTGTTGCCACTGCTAAGAGG 0: 1
1: 1
2: 0
3: 10
4: 140
Right 1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074984123 Original CRISPR CCTCAGAGGGAGACAGTCCA TGG Intergenic
No off target data available for this crispr