ID: 1074986127

View in Genome Browser
Species Human (GRCh38)
Location 10:118661519-118661541
Sequence GTGGTGTTCCTGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074986127_1074986134 24 Left 1074986127 10:118661519-118661541 CCCTTCTTCCTCAGGAACACCAC No data
Right 1074986134 10:118661566-118661588 CATAATCCCAAATTTCTTGGAGG 0: 51
1: 393
2: 7119
3: 3462
4: 2004
1074986127_1074986131 -7 Left 1074986127 10:118661519-118661541 CCCTTCTTCCTCAGGAACACCAC No data
Right 1074986131 10:118661535-118661557 ACACCACATATTCTTAGGTTTGG No data
1074986127_1074986133 21 Left 1074986127 10:118661519-118661541 CCCTTCTTCCTCAGGAACACCAC No data
Right 1074986133 10:118661563-118661585 TAACATAATCCCAAATTTCTTGG 0: 68
1: 223
2: 845
3: 7439
4: 3482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074986127 Original CRISPR GTGGTGTTCCTGAGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr