ID: 1074991082

View in Genome Browser
Species Human (GRCh38)
Location 10:118708713-118708735
Sequence GAGCGAGAACCTGAGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074991082_1074991089 11 Left 1074991082 10:118708713-118708735 CCAGAACGCTCAGGTTCTCGCTC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1074991089 10:118708747-118708769 CTCAGAAAAAAGGCCATGTGAGG No data
1074991082_1074991091 26 Left 1074991082 10:118708713-118708735 CCAGAACGCTCAGGTTCTCGCTC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1074991091 10:118708762-118708784 ATGTGAGGACTGCAGTGAGAAGG No data
1074991082_1074991086 1 Left 1074991082 10:118708713-118708735 CCAGAACGCTCAGGTTCTCGCTC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1074991086 10:118708737-118708759 TCCCATAGGGCTCAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074991082 Original CRISPR GAGCGAGAACCTGAGCGTTC TGG (reversed) Intronic
914713070 1:150232922-150232944 GAGCGAGTACCTGAGCTACCAGG + Intronic
919141779 1:193581768-193581790 GAGCTAGAAACTGAGAATTCAGG + Intergenic
920206261 1:204294432-204294454 GAGGAAGAACCTGAGAGGTCAGG + Intronic
920943565 1:210506853-210506875 GGGCAAGAACCAGAGCCTTCCGG - Intronic
924124847 1:240839806-240839828 GGGAGAGAAACTGAGAGTTCTGG - Intronic
924629130 1:245720835-245720857 GAGCAAGAACCTGTGCACTCAGG + Intergenic
1067395900 10:45917070-45917092 GAACAAGAACCTAAGTGTTCTGG + Intergenic
1067864223 10:49886195-49886217 GAACAAGAACCTAAGTGTTCTGG + Intronic
1070464128 10:76702853-76702875 GAGTGAGAACCTGTGTGTTTGGG + Intergenic
1074991082 10:118708713-118708735 GAGCGAGAACCTGAGCGTTCTGG - Intronic
1078541636 11:12217896-12217918 GAGCTATAGCCTGAGCGTCCAGG + Intronic
1078852605 11:15178375-15178397 GAGTGAGACCCTGAGCATGCTGG + Exonic
1081251810 11:40845388-40845410 GAGCGAGAACCTGATTGCCCTGG + Intronic
1083687635 11:64386254-64386276 GAGCGAGAACCAGATCCTTGGGG - Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1089576045 11:119444782-119444804 GACCTAGAAGCTGAGCCTTCTGG - Intergenic
1098658807 12:73067821-73067843 GATGGAGGACCTGAGCGGTCTGG + Intergenic
1102905259 12:116669710-116669732 GAGCGGGGACCTGTGCATTCAGG + Intergenic
1103735122 12:123056277-123056299 GAGCTATCACCTGAGCGCTCTGG + Intronic
1105702176 13:22941931-22941953 GGGCTAGAACCTCAGCTTTCAGG - Intergenic
1105854794 13:24363716-24363738 GGGCTAGAACCTCAGCTTTCAGG - Intergenic
1112298439 13:98209425-98209447 GAGGGAGAAGCTGAGGGATCAGG + Intronic
1114263835 14:21059187-21059209 GAGCAGGACCCTCAGCGTTCTGG + Intronic
1114488459 14:23079701-23079723 GACCGAGAACCTGAACTGTCAGG + Exonic
1116070295 14:40035373-40035395 GAGCGAGAGCATGAGCTCTCTGG + Intergenic
1123941045 15:25216802-25216824 GAGCCAGCACCTGAGCATTGTGG - Intergenic
1131266444 15:90918253-90918275 GAGCGAGCGCCGGGGCGTTCAGG - Exonic
1136294599 16:29294518-29294540 GAGCGAGATCCTGGGTTTTCAGG + Intergenic
1136866825 16:33766084-33766106 GAGCTGGAACCCAAGCGTTCTGG - Intergenic
1141577471 16:84973434-84973456 GAGCGAGTAGCTCAGCGGTCAGG - Intergenic
1203105336 16_KI270728v1_random:1350118-1350140 GAGCTGGAACCCAAGCGTTCTGG + Intergenic
1203128178 16_KI270728v1_random:1612250-1612272 GAGCTGGAACCCAAGCGTTCTGG - Intergenic
1147438705 17:40433667-40433689 TAGCGCTAACCTGAGAGTTCTGG - Intergenic
1152341388 17:79727765-79727787 GAGCTGGAACCCAAGCGTTCTGG - Intergenic
1163114107 19:15178932-15178954 CAGCGAGGACCTGAGCGAGCGGG + Exonic
1163830597 19:19545477-19545499 GTGCGAGACCCCGAGCGTCCGGG + Exonic
924992132 2:321292-321314 GAGCGGGACCCTGGGCTTTCAGG - Intergenic
928227394 2:29463720-29463742 GAGAGAGAATATGAGTGTTCTGG + Intronic
928294483 2:30070840-30070862 GAGGGTGAACCTTAGCTTTCTGG + Intergenic
948108533 2:235435168-235435190 GAGCTAGAATCTGAACGTACAGG + Intergenic
1168757167 20:325769-325791 GAGCGAGGAGCTGGGCGCTCGGG - Exonic
1169451227 20:5713354-5713376 GAGAGAGAAAGTGAGCTTTCTGG - Intergenic
1176039538 20:63056893-63056915 GAGTGAGAACCTGGGAGTGCAGG - Intergenic
1177810946 21:25924520-25924542 GAGTGAGAACATGAGTGTTTGGG - Intronic
1178617089 21:34143980-34144002 GACCGAGAGCCTGCGCTTTCAGG - Intergenic
1183327104 22:37200196-37200218 GAGCCAGAACCTGAGGTGTCTGG + Intergenic
953578850 3:44135427-44135449 GACTGAGAAACTGAGCATTCGGG - Intergenic
954603823 3:51893542-51893564 GAGCTAGAGCCTGAGACTTCTGG + Intergenic
966794827 3:183703181-183703203 TGGCGAGAAGCTGAGCGATCTGG - Intronic
978125527 4:105130888-105130910 GATAGAGAACCTGAGCCTTGTGG + Intergenic
980560891 4:134473905-134473927 GAGCAAGAACCTAATCTTTCAGG - Intergenic
982240518 4:153295438-153295460 GAGCGAGAAGCTGAACGAGCTGG + Exonic
984853696 4:184175181-184175203 GAGAGAGAAACCGAGAGTTCCGG - Intronic
987164670 5:15183669-15183691 GAGCCAGATCTTGAGCTTTCTGG - Intergenic
999114327 5:149149138-149149160 CAGCAAGAACCTGAGCTTTGGGG + Intronic
1003551853 6:7107781-7107803 GAGCGAGACTCCGAGCGTGCGGG + Intronic
1003952930 6:11134480-11134502 GAGGGAGATCATGAGCCTTCAGG + Exonic
1016390372 6:143568483-143568505 GAGGGAGAACCTGTGTGTTCAGG + Intronic
1019291045 7:250436-250458 GAGGCAGAACCTGAGCGTGGGGG + Intronic
1021252382 7:18346836-18346858 GAGCCAGAAGCTGAGAGTGCAGG + Intronic
1025271687 7:57526483-57526505 AAACAAGAACATGAGCGTTCTGG + Intergenic
1036664930 8:10731764-10731786 GAGTCAGAACCTTAGTGTTCAGG + Intronic
1046312782 8:112460190-112460212 GAGCTAGAATCTGAATGTTCAGG - Intronic