ID: 1074993655

View in Genome Browser
Species Human (GRCh38)
Location 10:118735844-118735866
Sequence ATAATTTAGCCTTTTAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 10, 3: 67, 4: 624}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074993655_1074993656 24 Left 1074993655 10:118735844-118735866 CCAAATTTAAAAGGCTAAATTAT 0: 1
1: 0
2: 10
3: 67
4: 624
Right 1074993656 10:118735891-118735913 CTAGATAATCAGAACAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074993655 Original CRISPR ATAATTTAGCCTTTTAAATT TGG (reversed) Intronic
901776953 1:11566673-11566695 ACAAATTAGACTTGTAAATTAGG + Intergenic
902111923 1:14086688-14086710 ATAATTTAGCTTTTACATTTAGG + Intergenic
902119469 1:14149789-14149811 ATAATCTAGCCTTTAAAATTAGG - Intergenic
902550138 1:17214477-17214499 ATGATTTGGCCTTTTTTATTTGG + Intronic
905138693 1:35822773-35822795 ATACTTTAATCATTTAAATTCGG - Intronic
905156583 1:35988611-35988633 ATTATTTAGCCTTTAAAAGAAGG - Intronic
906771056 1:48484498-48484520 ATCATTTAGCCTGTTATATTGGG - Intergenic
907895713 1:58688718-58688740 ATAATTTTGCCTTTTAATCCAGG + Intronic
908429283 1:64040179-64040201 AAAATTTAGCATTTTAAAATTGG + Intronic
908703576 1:66926596-66926618 AAAACTTAGCCTATTACATTTGG - Intronic
909275126 1:73674055-73674077 ATGATGTAGGCTTTTATATTTGG + Intergenic
909789097 1:79651159-79651181 ATACTCTAGACTTTTACATTAGG - Intergenic
910325875 1:86006529-86006551 ATAATATTGCATTTTACATTAGG - Intronic
910475245 1:87598862-87598884 ATATTTTTGCCTTTTTAATAGGG - Intergenic
910547577 1:88435161-88435183 ATCATTTAGCCTTTCTACTTAGG - Intergenic
910868611 1:91810699-91810721 ACATTTTAGCCTTTTAACCTGGG + Intronic
912593993 1:110855812-110855834 ATAATTTTGCCTTTTCAGATTGG - Intergenic
912622041 1:111171390-111171412 ATAATTTAAACTTTTAAACAAGG - Intronic
913083363 1:115410744-115410766 ATAATTCAGCCTCATCAATTGGG + Intergenic
913379864 1:118198090-118198112 TAATTTTAGCCTTTTAAATTTGG + Intergenic
913402044 1:118447360-118447382 ATAATTTAAACTTCTAACTTAGG + Intergenic
913507909 1:119535092-119535114 ATAATTTGGCCTTTAAATTTAGG - Intergenic
913510829 1:119560112-119560134 ATAGTTTAGCCCTTAAATTTAGG - Intergenic
913515052 1:119597517-119597539 ATAGTTTAGCCCTTAAATTTAGG - Intergenic
913563227 1:120044460-120044482 AAAATTTATACTTTTAATTTTGG - Intronic
913634896 1:120749127-120749149 AAAATTTATACTTTTAATTTTGG + Intergenic
914283822 1:146203818-146203840 AAAATTTATACTTTTAATTTTGG - Intronic
914544853 1:148654554-148654576 AAAATTTATACTTTTAATTTTGG - Intronic
914621719 1:149416124-149416146 AAAATTTATACTTTTAATTTTGG + Intergenic
914780395 1:150780688-150780710 ATAATTTTTTCTTTTAAACTTGG + Intergenic
916263325 1:162864127-162864149 GTAATGTACCTTTTTAAATTTGG - Intronic
916372213 1:164111094-164111116 ATTTTTTATCCTTTAAAATTTGG + Intergenic
916595534 1:166238929-166238951 AGTATATAGCCTTTTAAAATTGG + Intergenic
917951767 1:180045500-180045522 ATGATTTAATTTTTTAAATTGGG - Intronic
918227867 1:182502625-182502647 ATAATCTAGCCTTCCAGATTCGG - Intronic
918510578 1:185309489-185309511 ATCATTTTTCCTTATAAATTTGG + Exonic
918971302 1:191423184-191423206 TTATTTTGGCCTTCTAAATTTGG + Intergenic
919233095 1:194801327-194801349 ATAATTTTGCCTTTTAACTTGGG - Intergenic
919612100 1:199758166-199758188 ATAACTAAGCCTTTTGGATTTGG - Intergenic
921289544 1:213644619-213644641 AGAATGTAGCCTTTTTAGTTTGG + Intergenic
921468921 1:215525288-215525310 ATTAGTTAGCTTTTTAAAATTGG + Intergenic
921688580 1:218120629-218120651 AGAATTTTGCCTTATAAATCTGG - Intergenic
921735709 1:218625619-218625641 AAAATGTAGCATTTTAAAATTGG - Intergenic
922133717 1:222804903-222804925 ATAATCTAGCATTTAAAATGTGG + Intergenic
922602759 1:226870003-226870025 AAAATTTACCATTTTAAAGTGGG - Intergenic
923378572 1:233391576-233391598 GAAATTTAGCCTCTTAAATGTGG + Intergenic
924445370 1:244124859-244124881 CTTATTCAGCTTTTTAAATTGGG - Intergenic
1063588569 10:7374822-7374844 ACAATACAGCCTTTTAAAATGGG + Intronic
1064485224 10:15781234-15781256 AAATTTTAGTCTTTTAGATTTGG + Intronic
1064883820 10:20086977-20086999 ATTCTTTATCCTTTAAAATTTGG - Intronic
1065085950 10:22176546-22176568 ATAATCTTGCCTTTTACTTTGGG - Intergenic
1065163566 10:22950079-22950101 TTATTTTAGCTTTTTATATTTGG - Intronic
1065259625 10:23911120-23911142 ATATTTTAGCCTTTAAAATTGGG - Intronic
1065786568 10:29221158-29221180 ATAATTTTGCTTTTGAAACTTGG + Intergenic
1066397344 10:35039162-35039184 TTAATTCAGCCATTAAAATTTGG - Intronic
1067206404 10:44218115-44218137 ATAATTTTGACTCTTGAATTTGG - Intergenic
1067218053 10:44319411-44319433 ATAATTTTGATTTATAAATTAGG - Intergenic
1067395084 10:45908160-45908182 ATTTTTTAGCCTTTTAAAATTGG - Intergenic
1067863402 10:49877292-49877314 ATTTTTTAGCCTTTTAAAATTGG - Intronic
1068411855 10:56665984-56666006 ATAATTCTGCCTTTTAAACATGG - Intergenic
1068547471 10:58365141-58365163 ATATTTTATCCTTTTAGCTTGGG + Intronic
1071037224 10:81262863-81262885 ATAATTTAGCTTTTAAGTTTAGG + Intergenic
1072329533 10:94333591-94333613 CTAATTTGGCCTTTTAAAAAAGG - Exonic
1072359165 10:94642471-94642493 ATAATTTGGCCTTTTATATTTGG + Intergenic
1072386428 10:94934711-94934733 ATAGTTTTGCATTTTATATTTGG - Intergenic
1072443074 10:95474359-95474381 ATAATATCGCTGTTTAAATTTGG - Intronic
1073919162 10:108439285-108439307 AAAATTTTGCATTTTAAATAAGG + Intergenic
1074131471 10:110581772-110581794 CTATTTTAGTATTTTAAATTGGG + Intronic
1074356201 10:112785628-112785650 ATAGTTTAGCCTTTACATTTAGG + Intronic
1074629592 10:115236998-115237020 AGTATGTAGCCTTTTAATTTTGG + Intronic
1074786040 10:116841846-116841868 ATAATTTTGTCTTTTAGAGTTGG - Intergenic
1074921070 10:118013054-118013076 ACAGTCTAGCCTTTTAAACTAGG + Intronic
1074993655 10:118735844-118735866 ATAATTTAGCCTTTTAAATTTGG - Intronic
1075177519 10:120179293-120179315 ATAATTTAACTTCTTTAATTTGG + Intergenic
1076094844 10:127723030-127723052 ATAATTTAGTCTTTCTACTTAGG - Intergenic
1076524678 10:131104657-131104679 ATAATTTCCCCTTTTGAAATGGG - Intronic
1076575754 10:131465671-131465693 ATAATGTAGCCTTTTCAGATTGG + Intergenic
1080680153 11:34468151-34468173 ATAATTTTAAATTTTAAATTTGG - Intronic
1080974264 11:37317628-37317650 TTATTTTGGCCTTTTTAATTGGG + Intergenic
1081248864 11:40804292-40804314 ATATTTTTGCATTTTAATTTAGG - Intronic
1081284979 11:41257025-41257047 ATAAGTTTTCCTTTTAGATTGGG - Intronic
1081518349 11:43856529-43856551 ATATTTTAGCCCCTAAAATTAGG + Exonic
1081923332 11:46800083-46800105 ATATTTTACACTTTTATATTGGG - Intronic
1082919456 11:58477065-58477087 ACAATTTATCTTTTTAAAGTGGG - Intergenic
1083504280 11:63140988-63141010 ATTATTTAGCTTTTTACAATAGG + Intronic
1085140146 11:74132663-74132685 ATACTTTAGCCCTTTACTTTTGG - Intronic
1086305411 11:85474936-85474958 ATTTTTCTGCCTTTTAAATTAGG - Intronic
1087421616 11:97933744-97933766 ATCATTTTGCTTTTTAAAATAGG - Intergenic
1087477372 11:98653134-98653156 ATCATTTTTTCTTTTAAATTAGG + Intergenic
1087800009 11:102493380-102493402 ATAAATTAGCCTAAAAAATTAGG - Intronic
1088028082 11:105210895-105210917 ATAATTTTGCATATGAAATTTGG - Intergenic
1088412229 11:109547204-109547226 AAAATTAAGCTTTTTAATTTGGG - Intergenic
1088570206 11:111215501-111215523 ATCATTTAGCCTTTCTACTTAGG - Intergenic
1089059572 11:115615436-115615458 ATAAATTAGGCTTTGAAAGTGGG - Intergenic
1089529620 11:119118090-119118112 ATAATTTAGTTTTATATATTTGG + Exonic
1090031161 11:123207689-123207711 ATAATTTTACTTTTGAAATTTGG - Intergenic
1090051311 11:123382195-123382217 ATAAATTAATATTTTAAATTAGG + Intergenic
1091952812 12:4608969-4608991 ATAATTCAGCCTTTTGGATTAGG + Intronic
1092292809 12:7173930-7173952 ATTATGTAGCCTTTTTAAATTGG + Intergenic
1093092941 12:14941775-14941797 TTAATTTCGACTTTTATATTAGG - Intergenic
1093417632 12:18938198-18938220 AAAATTGAGCCTTTTAAAGTAGG + Intergenic
1093513661 12:19959293-19959315 ATAATTTTAACTTTTATATTTGG + Intergenic
1093828531 12:23725748-23725770 ACAATTCAGCCTTTTAAAGATGG + Intronic
1093845115 12:23961539-23961561 AGACGTTAGCCTTATAAATTGGG - Intergenic
1094399186 12:30043151-30043173 CTAATAGAGCCTTTTAAAATAGG + Intergenic
1094785342 12:33842023-33842045 ATTATTTAGCCTTTAAAAAAAGG - Intergenic
1094809329 12:34122552-34122574 ATACTTTAGCATTTTAGAATTGG + Intergenic
1095363866 12:41377939-41377961 ATAATTCTTCCTTTTCAATTTGG + Intronic
1097508842 12:60509693-60509715 ATCATTTAGTCTTTTAATTTAGG - Intergenic
1097927978 12:65152030-65152052 ATTATTTAGCCTTTAAAAAAAGG + Intergenic
1098502414 12:71208432-71208454 ATCATTTAACCCTTTAAACTAGG - Intronic
1098609493 12:72437398-72437420 ATATTTTAGGCTTTTAAAAGAGG + Intronic
1098708210 12:73718922-73718944 ATAATTGATATTTTTAAATTAGG - Intergenic
1099353437 12:81603596-81603618 TTAATTTAGGCTTATTAATTAGG + Intronic
1099355217 12:81626357-81626379 ATAATGTAGCCTTAAAATTTGGG - Intronic
1099654740 12:85475303-85475325 TGAATTTAGCATTTTAAATAAGG - Intergenic
1099736902 12:86579548-86579570 ATCATTTAGTCTTTTTACTTAGG + Intronic
1100484690 12:95013983-95014005 ATCATTTTCCCTCTTAAATTTGG + Intergenic
1100931148 12:99610721-99610743 ATAAATTAACTTTTCAAATTAGG - Intronic
1100968210 12:100036830-100036852 GTAATTTATCCTGCTAAATTTGG - Intronic
1102146817 12:110660587-110660609 AAAATTTACCATTTTAAAGTTGG + Intronic
1103501545 12:121406919-121406941 ATAATTTCAACTTTTAGATTTGG + Intronic
1103697368 12:122827432-122827454 CTCATTTAGCCTTTTTAATTAGG + Exonic
1103849520 12:123922940-123922962 ATAATTTAGCCCTTAACAGTTGG + Intronic
1105488713 13:20864895-20864917 AAAATTTCTTCTTTTAAATTAGG - Intronic
1106086385 13:26546108-26546130 ATAATTTAGGATTTTAGTTTTGG + Intergenic
1106165396 13:27241327-27241349 TTACTATAGCCTTTTAAAATAGG - Intergenic
1106330674 13:28736635-28736657 ATAAATTAGCCTTTCACTTTAGG + Intergenic
1106489358 13:30203911-30203933 CTTATTTATACTTTTAAATTAGG - Exonic
1107083707 13:36403397-36403419 ATCATTTAGTCTTTTTACTTAGG + Intergenic
1107243323 13:38264241-38264263 ATATTTTATATTTTTAAATTTGG - Intergenic
1107846732 13:44522019-44522041 ACAATATATGCTTTTAAATTGGG + Intronic
1107848127 13:44540187-44540209 ATAATTTATCATTTTTGATTTGG - Intronic
1107906242 13:45063840-45063862 TTAATTTAGTCTTTTAGATGGGG - Intergenic
1108834762 13:54529572-54529594 ATAAATTTTCCTTTTAATTTGGG - Intergenic
1109435820 13:62300421-62300443 TGTATTTATCCTTTTAAATTAGG - Intergenic
1110447628 13:75604553-75604575 ATAATTTAGGCTTTCAAATATGG + Intronic
1110588842 13:77229786-77229808 ATATTATAGCCTTTGGAATTAGG - Intronic
1110681474 13:78318540-78318562 ATATTTTAGCATTTAACATTTGG - Intergenic
1110685190 13:78364140-78364162 ACATTTTAGCCTTTCAAATCTGG + Intergenic
1110997478 13:82131114-82131136 GTCCTTTAGCCATTTAAATTTGG + Intergenic
1111097071 13:83530813-83530835 ATAAGTGAGCCCTTTAAAGTCGG + Intergenic
1111448472 13:88382032-88382054 AAATTTTAGCCTCTTATATTGGG + Intergenic
1111776279 13:92666712-92666734 ATAATTTATCATTTGACATTTGG + Intronic
1111933522 13:94536104-94536126 AAAATTTAGCCTTTTATTTAAGG + Intergenic
1111970556 13:94910118-94910140 ATAATTTATTCTTTTACAATTGG + Intergenic
1112102823 13:96209031-96209053 ATAATTTCGGATTTTGAATTTGG + Intronic
1112373629 13:98818169-98818191 ATAATATAGCTTACTAAATTAGG - Intronic
1112657292 13:101464607-101464629 ATATTTTACCCATTTATATTTGG + Intronic
1112670549 13:101631922-101631944 CTAGTTTAGACTTTTACATTCGG - Intronic
1114864104 14:26566848-26566870 AGCATTTAGCCTTTTAAAAATGG - Intronic
1115613081 14:35067362-35067384 ACAATTCAGCCTTTAAAAATAGG - Intronic
1115949684 14:38706523-38706545 ATAATTTCCTTTTTTAAATTGGG + Intergenic
1116107197 14:40525204-40525226 ATAATTTATCCCTGTAAATCTGG + Intergenic
1116164826 14:41322135-41322157 ATGATTTAGCATTTTAAACCTGG + Intergenic
1116460696 14:45169767-45169789 ACTATTTAGCCTTTTCAGTTTGG + Intronic
1116605730 14:46992240-46992262 CTAATTTGGAATTTTAAATTTGG + Intronic
1116762329 14:49029757-49029779 ATATTTTAACCATTTAAATTAGG - Intergenic
1116832699 14:49737937-49737959 CTAATTTACCCTCTAAAATTGGG + Intronic
1116850601 14:49904971-49904993 ATATTTTATACATTTAAATTAGG + Intergenic
1117138100 14:52758207-52758229 ATAAATTAGCCCTTTAAATAAGG - Intronic
1117526810 14:56615798-56615820 AAAATTTTGTCTTTTAAAGTTGG - Intronic
1117635148 14:57735250-57735272 AATATTTAGGCTTTTAAAATAGG - Intronic
1118676615 14:68192434-68192456 ATAATTTGATCTTTCAAATTTGG - Intronic
1119006242 14:70932165-70932187 TAAATTTAGTGTTTTAAATTTGG + Intronic
1119885817 14:78140926-78140948 ATAATTCAGACTTTTAAAAATGG + Intergenic
1119962504 14:78875636-78875658 CTTATTTAGCTTTTTTAATTGGG - Intronic
1119965338 14:78908973-78908995 ATAACCTAGGCTTTTCAATTAGG - Intronic
1120153244 14:81061783-81061805 ATTATTTTACCTTTTAATTTAGG - Intronic
1120200040 14:81527642-81527664 ATAATTCATCCTTTTAAATCAGG + Intronic
1120272691 14:82334829-82334851 ATACTTTAGCATTTTATTTTTGG - Intergenic
1120342103 14:83234624-83234646 ATAATTTATCATTTTCTATTGGG + Intergenic
1122174118 14:99904352-99904374 ATAATTTAACCTTTTAATCTAGG + Intronic
1122466390 14:101936668-101936690 AAAATTTAGCTTTTTAATATGGG - Intergenic
1122676698 14:103420930-103420952 ATGATTTTGCCATTTAAAATGGG + Intronic
1123150586 14:106177813-106177835 ACAATTTTGCCTTTTAAATGTGG + Intergenic
1123202703 14:106681525-106681547 ATAATTTTGCCTTTTAAATGTGG + Intergenic
1123399006 15:19965557-19965579 ATAATTTTGCCTTTTAAATGTGG + Intergenic
1124579501 15:30940762-30940784 ATAATTTCACTTTTTAAAATTGG - Exonic
1124970099 15:34480157-34480179 ATAATTTATCATTTGACATTTGG + Intergenic
1125069051 15:35529999-35530021 ACAACTTTACCTTTTAAATTGGG - Intronic
1125265448 15:37874558-37874580 ATAATTTAGCCATGCAAATACGG - Intergenic
1125434685 15:39632103-39632125 ATATTTTAGCATATTTAATTAGG - Intronic
1125458615 15:39886880-39886902 ATACTTTTTCCATTTAAATTAGG - Intronic
1125469625 15:39990190-39990212 CTAGGTTGGCCTTTTAAATTAGG + Intronic
1125486988 15:40118355-40118377 ATAATTTAGTCTTATATTTTGGG + Intergenic
1126216455 15:46159968-46159990 ATTATTTAGTCTTTCTAATTAGG - Intergenic
1127010930 15:54626676-54626698 GTATTTTAACCCTTTAAATTTGG - Intronic
1127949062 15:63786641-63786663 ATTATATAGCCTTTTATATCTGG - Intronic
1129996919 15:80014704-80014726 ATGATTTTGCATTTTACATTTGG + Intergenic
1130666762 15:85876293-85876315 ATTATGTAGCCTTTTAAATACGG - Intergenic
1131654217 15:94438092-94438114 ATATATTAGTCTTTTACATTAGG - Intronic
1132189248 15:99835876-99835898 ATAATTTATCATTTGACATTTGG - Intergenic
1133641695 16:7723390-7723412 CTATTTTAAGCTTTTAAATTTGG - Intergenic
1135004289 16:18804483-18804505 AAAATTAAGCTTTATAAATTGGG + Intergenic
1135149807 16:19995544-19995566 ATAATTTCAACTTTTAGATTTGG + Intergenic
1135850985 16:25963650-25963672 ATAATTTAGTCTTGTAATGTTGG + Intronic
1137041693 16:35618791-35618813 AAAATTTAACCTTTTAATGTAGG + Intergenic
1137242733 16:46671212-46671234 ATAATTTATACTTGCAAATTTGG + Intronic
1137761237 16:50942226-50942248 ATAATTTATTTTTTAAAATTAGG + Intergenic
1137955954 16:52829405-52829427 ATAATTGATCCTCTTTAATTAGG + Intergenic
1138177466 16:54914202-54914224 CTATTTTAGCCTCTTAAAATTGG + Intergenic
1138836558 16:60443633-60443655 ATAAGTTAGCATTTTGTATTAGG - Intergenic
1138868909 16:60856925-60856947 ATAAATTAGTCTTTTACTTTTGG + Intergenic
1138951061 16:61913881-61913903 ATAATTTAGCCTATAACAGTGGG - Intronic
1139228377 16:65255530-65255552 ATAATTCTGCCTTATAAATCTGG + Intergenic
1139415600 16:66806366-66806388 ATCATTTAGTCTTTTAGAATTGG - Intronic
1140102474 16:71929874-71929896 ATTATGTAGTCTTATAAATTGGG + Exonic
1140290261 16:73647278-73647300 ATTATTTATCCTTTAAAAGTTGG - Intergenic
1141050632 16:80760051-80760073 AAAATTTAGATTTATAAATTGGG + Intronic
1143243840 17:5466981-5467003 ATTATTTAACCTTTTAACGTAGG - Intronic
1143294187 17:5858290-5858312 TTAATTTAGCAATTTTAATTGGG + Intronic
1143468037 17:7151253-7151275 ATTATCCAGTCTTTTAAATTTGG + Intergenic
1144243840 17:13342299-13342321 TTCATTTTGCCTTTTAATTTTGG - Intergenic
1145875135 17:28313379-28313401 ATCAATTAGCCTTTTTAATAGGG + Intergenic
1146494200 17:33306430-33306452 ACAATGTATCCTTTTAAATTTGG + Intronic
1146895504 17:36538207-36538229 CAAATTTAGCCTTTTGTATTTGG + Exonic
1147054013 17:37820146-37820168 ATAATTATACCTTGTAAATTTGG - Intergenic
1147484699 17:40801432-40801454 AGAATTTAGAATTTTAAAGTAGG + Intergenic
1148272462 17:46272879-46272901 AAAATTTACCCTTTTTAATTTGG + Intergenic
1148909176 17:50931349-50931371 ATAATTTCCTCTTTTAATTTGGG - Intergenic
1149166998 17:53763929-53763951 ATTATTCAGCCTTTTAAAGAAGG - Intergenic
1149321295 17:55484036-55484058 ATAAATTATCCTCATAAATTAGG - Intergenic
1150191422 17:63244580-63244602 ATCATTTGTCCTTTTCAATTGGG + Intronic
1150881113 17:69029438-69029460 ATATTTTAGCCTGTTCATTTTGG - Intronic
1151106502 17:71622048-71622070 ATATAGTAGCTTTTTAAATTAGG - Intergenic
1152004887 17:77674200-77674222 ATAATTTTGCCTTGTTTATTTGG - Intergenic
1153414142 18:4826429-4826451 CTAATTTATGCTTTGAAATTAGG - Intergenic
1153789650 18:8566335-8566357 ATAGTTTAGTTTTTTATATTAGG - Intergenic
1153873756 18:9346240-9346262 AGAATGTAGCCTTTTAAAAGGGG + Intronic
1153980635 18:10305969-10305991 ATATTTTAGCTTTTAAATTTAGG + Intergenic
1155984346 18:32214094-32214116 ATAATTCAGCGTTTGAAATGGGG + Intronic
1156567523 18:38210887-38210909 ATAATTTAGTTTTTTAAGTTTGG - Intergenic
1156691854 18:39716863-39716885 ATAGTTTAGCCTTTACATTTAGG + Intergenic
1156810408 18:41242416-41242438 ATTATGTAGCCTTTTAATATTGG + Intergenic
1157504202 18:48214772-48214794 ATTATTTAGCCTTAAAAAGTAGG - Intronic
1157890604 18:51412863-51412885 ATCATTCAGCCTTAAAAATTAGG + Intergenic
1158030293 18:52955309-52955331 AGTATGTAGCCTTTTAAAATTGG + Intronic
1158442361 18:57488128-57488150 TTTATTTGGCCTTATAAATTAGG + Exonic
1160288725 18:77570849-77570871 ATTTTTTTGCCTTTTAAACTTGG - Intergenic
1162695858 19:12474369-12474391 ATGATTTAGCCTTTAAAAAAAGG - Intronic
1163224422 19:15946792-15946814 ATTATTTACCATTTTTAATTTGG + Intergenic
1163537366 19:17884457-17884479 ATAAATTAGCCATTTAAAAGTGG + Intronic
1163541074 19:17910770-17910792 TTAATTTATTTTTTTAAATTTGG + Intergenic
1164740793 19:30574134-30574156 CTAATTTGACCTTTTAATTTTGG - Intronic
1166221801 19:41369829-41369851 ATAAATAAGCCTTTTAATTGTGG + Intronic
1166325512 19:42048062-42048084 ATAATTTTGCCTTTTACATTTGG - Intronic
1166417197 19:42604483-42604505 ATAATTTATCTATTTAGATTAGG - Intronic
1167718947 19:51164480-51164502 AAAATGTAGCCTTTAAAATCTGG - Intergenic
1168445939 19:56413882-56413904 ACAATTTAACTTTTTAACTTAGG + Intronic
1168511206 19:56974853-56974875 ATAATTTAGCTGTTAAAATTAGG + Intergenic
927800274 2:26092487-26092509 ATTACTAAACCTTTTAAATTTGG - Intronic
928783792 2:34856595-34856617 ATAATTTAGTCTTTTTAATTAGG - Intergenic
929183901 2:39073254-39073276 ATAAATAAGCATTTCAAATTGGG + Intronic
929400746 2:41578596-41578618 ATTATTTACCCTTTTCATTTTGG + Intergenic
929421714 2:41797143-41797165 ATAATTTTGCATTTTAAATTAGG + Intergenic
929652293 2:43692492-43692514 ATATTTTATCCTTTGAATTTAGG + Exonic
930389158 2:50738353-50738375 AGAAATTTGCTTTTTAAATTTGG - Intronic
930524881 2:52516008-52516030 ATTATTCAGCCTTTTAAAAAAGG + Intergenic
930611404 2:53548120-53548142 TTAATTTAGCTTTTTAAATGCGG - Intronic
930644950 2:53895988-53896010 AAAATTAATCCTTTTAATTTTGG - Intronic
930763399 2:55060174-55060196 AGAATTTAGCTTTTTATATTTGG + Intronic
930959872 2:57248613-57248635 TTAATTGAGCATTTTAAGTTTGG + Intergenic
931030278 2:58167970-58167992 ATAATTTATTTTTTTCAATTTGG - Intronic
931833922 2:66079693-66079715 ATAATATAGATATTTAAATTAGG + Intergenic
932661610 2:73658487-73658509 ATAATTTTAGCTCTTAAATTAGG + Intergenic
932963231 2:76440656-76440678 AAAATCTAGTCTTTCAAATTTGG - Intergenic
933491223 2:82987232-82987254 ATAAATTTGAGTTTTAAATTAGG - Intergenic
933834930 2:86238237-86238259 ATAATATTGCCAATTAAATTAGG - Intronic
933915832 2:86992495-86992517 AGAATCTAGTCTTTTAATTTTGG + Intronic
934007161 2:87777407-87777429 AGAATCTAGTCTTTTAATTTTGG - Intronic
935040779 2:99424899-99424921 AAAATTTACCATTTTCAATTAGG - Intronic
935136556 2:100308925-100308947 GAGATTTAGTCTTTTAAATTAGG + Intronic
935577638 2:104727465-104727487 ATTTTTTTGCCATTTAAATTAGG + Intergenic
935770803 2:106418312-106418334 AGAATCTAGTCTTTTAATTTTGG - Intronic
935909279 2:107877625-107877647 AGAATCTAGTCTTTTAATTTTGG + Intronic
935967415 2:108494626-108494648 AGAATCTAGTCTTTTAATTTTGG + Intronic
936085628 2:109466698-109466720 ATAGTTTTGCATTTTACATTTGG + Intronic
936131058 2:109842765-109842787 AGAATCTAGTCTTTTAATTTTGG + Intronic
936213639 2:110528720-110528742 AGAATCTAGTCTTTTAATTTTGG - Intronic
936269133 2:111035207-111035229 AGAATTTAGCCATTTTTATTAGG + Intronic
936422777 2:112383280-112383302 AGAATCTAGTCTTTTAATTTTGG - Intronic
936559937 2:113528693-113528715 ATGAATTAGACTTTTAAATCAGG + Intergenic
936747677 2:115598721-115598743 ATAATTTAACATTTTTAATGCGG + Intronic
937568551 2:123328629-123328651 ATAATTAAGCCTTTAAAACATGG + Intergenic
937575492 2:123416242-123416264 GTTATGTAGCCTTTTAAAATTGG - Intergenic
937664825 2:124474316-124474338 ACAATATAGGCTTTTAAACTAGG + Intronic
939106867 2:137959091-137959113 ATAAATAAGAATTTTAAATTAGG + Intergenic
939306900 2:140423540-140423562 ATAAATTATTCTTTTTAATTTGG - Intronic
939442987 2:142273973-142273995 ATCATTTAGCCTTTTTACTTAGG + Intergenic
940136508 2:150442279-150442301 TTATTTCAACCTTTTAAATTAGG - Intergenic
940394080 2:153167255-153167277 ACATTTTTGCCTTTTAAACTTGG + Intergenic
940459416 2:153944246-153944268 TTTATTTAGGCTTTTAATTTTGG + Intronic
941140532 2:161775100-161775122 ATAATTTAGGCCTTTAAAAGCGG - Intronic
941214283 2:162686224-162686246 TTAATTTGGGCTTTTGAATTGGG - Intronic
941893088 2:170602433-170602455 ATAGCTTAGCCTTTTAATTTGGG + Intronic
943079628 2:183242662-183242684 AAAATTTGTCTTTTTAAATTTGG + Intergenic
943098593 2:183458869-183458891 CTACTTAAGCCTTTTAATTTTGG + Intergenic
943784199 2:191859138-191859160 TTATAGTAGCCTTTTAAATTTGG - Intergenic
943915798 2:193630330-193630352 ATCATTTAGTCTTTTTACTTAGG - Intergenic
944340478 2:198590693-198590715 AAATTTTAGACTGTTAAATTTGG + Intergenic
947691760 2:232144080-232144102 ATAATTTAGCAATGTACATTTGG + Intronic
947702746 2:232248631-232248653 ATAATTTAGGCTTAAAAAATGGG + Intronic
947775926 2:232709330-232709352 AAAATTTCATCTTTTAAATTGGG + Intronic
948615748 2:239197659-239197681 ATATTCTAACCTTTTAAATGAGG + Intronic
949011454 2:241681567-241681589 ATAGTTTTGCATTTTACATTTGG - Intronic
1169312638 20:4559516-4559538 ATTATGTAGGCTTTTAAAATTGG - Intergenic
1170105057 20:12746253-12746275 GTTATTTAGCCTTTCTAATTTGG + Intergenic
1170262588 20:14427049-14427071 AGAATTTAGCAGTATAAATTTGG + Intronic
1170313792 20:15020496-15020518 AATATGTAGCCTTTTAAAATTGG - Intronic
1170418548 20:16169779-16169801 ATATTTTAAACTTATAAATTAGG - Intergenic
1170663161 20:18362484-18362506 ATACTTAAGCCAGTTAAATTAGG - Intergenic
1171008033 20:21486926-21486948 ATATTTTAGCCCCTAAAATTAGG - Intergenic
1171043640 20:21789756-21789778 AAAAGTTATCCTTGTAAATTGGG + Intergenic
1172430479 20:34887037-34887059 ATAATTTGGCCTTTTACTTTTGG + Intronic
1173027466 20:39321912-39321934 ATAATTTATTTGTTTAAATTAGG + Intergenic
1173099132 20:40067537-40067559 ATCATTTAGTCTTTTTACTTAGG - Intergenic
1173296226 20:41760815-41760837 ATAATTTTCCATTTTTAATTAGG - Intergenic
1174168661 20:48603171-48603193 ATAATTTTGTGTTTTACATTTGG - Intergenic
1174718459 20:52785436-52785458 ATAATTTAACTTTTAAATTTTGG - Intergenic
1174927763 20:54779269-54779291 ATTAACTAGCCTGTTAAATTGGG + Intergenic
1175775249 20:61649006-61649028 ATAATTGAGAATCTTAAATTTGG - Intronic
1176745691 21:10650290-10650312 ACAATTTTGCCTTTTAAATGTGG + Intergenic
1177297405 21:19194300-19194322 ATTATTTATCCTTTTCAATGAGG - Intergenic
1177360245 21:20059545-20059567 CTAATTAAGCCTTATAAAGTGGG - Intergenic
1177936195 21:27349192-27349214 ATAATTATGCTTTTTAAACTTGG + Intergenic
1178161496 21:29921561-29921583 TTAATTAAGTCTTTTGAATTTGG + Intronic
1178161502 21:29921695-29921717 TTAATTAAGTCTTTTGAATTTGG + Intronic
1178267077 21:31153507-31153529 ATATCTTAGTCTTTTAAATCAGG - Intronic
1182273949 22:29172793-29172815 ATTATTCAGCCTTTTACATACGG - Intergenic
1182611683 22:31553291-31553313 ATCTTTTGTCCTTTTAAATTGGG + Intronic
1182682417 22:32091054-32091076 ATCCTTTGGCATTTTAAATTGGG + Intronic
1183855785 22:40633648-40633670 ATATTTTATACTTATAAATTTGG - Intronic
1183915854 22:41118381-41118403 ATATTTTAAACTTTTAAATGTGG + Intronic
949379194 3:3426114-3426136 ATATTTTGTCTTTTTAAATTAGG - Intergenic
949785473 3:7735683-7735705 ATAATTATGCCTTTTAGATGGGG + Intronic
950247297 3:11432772-11432794 AAAATGTTGCCTTGTAAATTAGG + Intronic
950346570 3:12299896-12299918 ATAATTTGGTCGTTTAAAATAGG - Intronic
950603131 3:14053452-14053474 ATAATTTAGCCTTACACACTAGG + Intronic
950692857 3:14674212-14674234 ATAATTTCACTTTTTAAATATGG - Intergenic
950797843 3:15524942-15524964 ATATTTTAGCATTTACAATTAGG - Intergenic
950939127 3:16875710-16875732 ATTTTTCTGCCTTTTAAATTAGG - Intronic
951483120 3:23182843-23182865 ATAATTTAGCCATGTATTTTGGG + Intergenic
953099755 3:39812396-39812418 ATAATTTAGCCTTACAATCTGGG + Intronic
955373226 3:58371720-58371742 GTAATTTTACCTTTTAAAATGGG + Intronic
955438208 3:58927106-58927128 ATAATTTATGCTTTTAACTTGGG - Intronic
955532922 3:59892971-59892993 GTAATTCAGCTTTTTAAATATGG - Intronic
955553193 3:60106873-60106895 GTATTTTATCCTTTTTAATTTGG + Intronic
955594839 3:60577332-60577354 TTAATTTAGCCCCTTACATTAGG + Intronic
956147230 3:66202917-66202939 ATAATTTTACGTTTTAAATTTGG - Intronic
956238399 3:67102454-67102476 GTAGTTTTGCCTTTTAATTTAGG - Intergenic
956282138 3:67569214-67569236 AGAATTTAGCATTTTTAATCTGG - Intronic
956900509 3:73711012-73711034 ATAATATATCATTTTAAATTAGG + Intergenic
957226737 3:77458758-77458780 ATAATTTAGCTTTGTAACTAAGG - Intronic
957227064 3:77463344-77463366 AAAATTTATACTTTTAGATTGGG + Intronic
957579205 3:82049080-82049102 AGAATACAGCCTTTTGAATTCGG + Intergenic
957602998 3:82362323-82362345 ATAATTTAGCTTTAAAAATGTGG + Intergenic
957870529 3:86085508-86085530 ATATTTTCTCCTTTTGAATTTGG + Intergenic
958592362 3:96174354-96174376 TTCATGTAGCCTTTTAAATTTGG - Intergenic
958661538 3:97074340-97074362 TTAATTTACTCTTTAAAATTTGG + Intronic
958844848 3:99253626-99253648 AGAATGTAGCATTTTATATTTGG - Intergenic
959167159 3:102794724-102794746 ATAATTTATCGTTTTAAGGTTGG + Intergenic
959224965 3:103568662-103568684 ATAATTTATGATTTTAATTTTGG + Intergenic
959226382 3:103593098-103593120 ATAATTTTGCATTTTACAGTAGG + Intergenic
959358128 3:105358003-105358025 ATAATCTAGCCCTTTAAAATAGG + Intergenic
959367892 3:105486850-105486872 ATAATTCATCCATTTAAAGTTGG - Intronic
959792563 3:110380944-110380966 AGAATCTAGCCTTCTTAATTTGG + Intergenic
960110615 3:113841202-113841224 CCAATTTGGCCTGTTAAATTTGG - Intronic
960661347 3:120063044-120063066 ATTAGTTAACCTTTTAAGTTTGG - Intronic
961226803 3:125257244-125257266 ATAATTTCTTCTTTTAAAATAGG + Intronic
961837493 3:129675177-129675199 TAAATTTTGCCTTTTACATTTGG - Intronic
962096852 3:132301254-132301276 ATATTTTAACCTTTTAATGTCGG + Intergenic
962276163 3:134015246-134015268 ATTATTCAGCCTTTTAAAAGGGG + Intronic
962282059 3:134059613-134059635 ATAATTGAACTTTTTAAAATTGG + Intergenic
962568142 3:136684884-136684906 ATAGTTTTACCTTTTACATTTGG - Intronic
962992928 3:140595929-140595951 AGTATGTAGCCTTTTAAAATTGG + Intergenic
963219073 3:142786566-142786588 AAAATTTAATCTTTTAATTTAGG + Intronic
963458488 3:145577002-145577024 ATACTTTAACCTTCTAAACTAGG + Intergenic
963569975 3:146981462-146981484 ATGAGTTAGCCTTTCAAAATGGG - Intergenic
963579007 3:147100358-147100380 ATAATTTAGGATGTTAGATTAGG - Intergenic
963610892 3:147466566-147466588 ATAATTCATCATCTTAAATTGGG - Intronic
963623775 3:147645464-147645486 ATCATGTAGAATTTTAAATTCGG - Intergenic
963822844 3:149918066-149918088 TTTTTTTAACCTTTTAAATTTGG - Intronic
964377413 3:156062831-156062853 ATAAATTAGCCATAAAAATTTGG - Intronic
964412311 3:156410727-156410749 ATATTGTAGCCTTTTGAGTTTGG + Intronic
965102553 3:164319406-164319428 ATGATTTTACCTTTTAAATTTGG - Intergenic
965191945 3:165542208-165542230 AAAATGTATCCATTTAAATTAGG + Intergenic
965361105 3:167739146-167739168 AGAATTTAGTCTTTAAAATTTGG + Intronic
965683042 3:171271779-171271801 TTAATTTTTTCTTTTAAATTCGG - Intronic
966041747 3:175499441-175499463 TTAAATTACTCTTTTAAATTGGG + Intronic
966258972 3:177952617-177952639 AGTATGTAGCCTTTTAGATTTGG + Intergenic
966315257 3:178637546-178637568 ATAATTTCACCTTATAGATTGGG - Intronic
966444575 3:179987326-179987348 TTAATTCAACCTTTTAAATGGGG - Intronic
966552031 3:181215934-181215956 GCAAATTAGCCTTTTAAAGTGGG + Intergenic
966679796 3:182629770-182629792 AGAATTTAGCCAGTTAAAGTGGG + Intergenic
967392797 3:188973657-188973679 ATAATTTAGCCTTTCACAAGGGG - Intronic
967459291 3:189726571-189726593 ATATTTTAGCACTTTAAATATGG - Intronic
967731992 3:192915701-192915723 ATAATTTACTTTTTTATATTTGG + Intronic
967778658 3:193411894-193411916 ATAAATTGGTCTTTTCAATTTGG + Intronic
967947517 3:194815840-194815862 ATAATGCAGCCTTTTAAAGTTGG + Intergenic
968635865 4:1678884-1678906 ATAGTTTTGCCTTTTACTTTAGG - Intronic
969880703 4:10171357-10171379 GTAACTTAGCATTTTCAATTGGG + Intergenic
969951389 4:10840019-10840041 ATAAAGTAGCCTTTAAAAATGGG - Intergenic
970226609 4:13864891-13864913 AGTATATAGCCTTTTAAAATTGG + Intergenic
971784321 4:31081275-31081297 AACATTTAGCCTTTTGAATAAGG + Intronic
971843250 4:31882305-31882327 ATAATTTTGCATTTAAATTTCGG + Intergenic
972052569 4:34757358-34757380 ATAATTAAGAATTTTAAATTAGG - Intergenic
974635034 4:64552835-64552857 AGAAATTATCATTTTAAATTAGG + Intergenic
974709293 4:65568635-65568657 ATAATTTATTCTTTGAAAATGGG - Intronic
974822542 4:67085592-67085614 AAAATCTAGACTTTTAAATGTGG - Intergenic
975252936 4:72200289-72200311 ATCATTTAGTCTTTTTACTTAGG - Intergenic
975525195 4:75341134-75341156 ATAAATGAGGCTTGTAAATTTGG - Intergenic
975893018 4:79051693-79051715 ATACGTTTTCCTTTTAAATTTGG + Intergenic
976055011 4:81053926-81053948 ACAATTTCGCGTTTTGAATTAGG + Exonic
976378277 4:84370132-84370154 ATAATTTTGACTTTTAGATTCGG + Intergenic
977103282 4:92846164-92846186 ATAATTTCACCTTTTATTTTAGG + Intronic
977325314 4:95567874-95567896 ATCAGTTATCCTTTTGAATTTGG + Intergenic
977429692 4:96915699-96915721 ATAATGTAACATTTTAAATTCGG - Intergenic
977487097 4:97662922-97662944 ATAATTTCAACTTTTATATTCGG - Intronic
977521096 4:98084638-98084660 TTACTTTAGCCATTTAAATGGGG + Intronic
977754783 4:100655769-100655791 ATAAATTATCCTTATTAATTTGG + Intronic
977942535 4:102874468-102874490 ATAATTTCGACTTTTATTTTAGG - Intronic
978281157 4:107016536-107016558 ATAATTTAGGAATTTAAATTAGG - Intronic
978483615 4:109224392-109224414 ATTATTTATCCTTCTAAGTTCGG + Intronic
978875906 4:113639831-113639853 AGAATTTAGCCTGATAAATTAGG + Intronic
979152020 4:117330698-117330720 CTCATTTAGCCTTATTAATTTGG + Intergenic
979594844 4:122523592-122523614 ATCATTTAGTCTTTTTACTTAGG + Intergenic
979609882 4:122678533-122678555 ATCTTTTTGCCTTTTAAATTAGG + Intergenic
979615244 4:122734734-122734756 ATGATTTAGGCTTTTATATTTGG + Intronic
980269095 4:130561330-130561352 ATAATTTTGATTTTTAAAATTGG - Intergenic
980386783 4:132096019-132096041 ATACTTTAAACTTTTAAAATTGG + Intergenic
980438906 4:132815906-132815928 ATATTTTAACCTTTTAATGTAGG + Intergenic
980590500 4:134881640-134881662 ATCATTGATCCTTTTCAATTGGG - Intergenic
980635990 4:135503792-135503814 ATAGTTTTGCATTTTACATTAGG - Intergenic
981234205 4:142395711-142395733 ATTATTTAGCCTTAAAAAATAGG + Intronic
981651736 4:147067969-147067991 ATAAATTATCACTTTAAATTAGG + Intergenic
982141443 4:152323819-152323841 ATAAGGTAGCCCTTTAAAATTGG + Intronic
982548792 4:156770347-156770369 ATAACTAAGGATTTTAAATTTGG + Intronic
982593657 4:157349687-157349709 ATATCATAGACTTTTAAATTAGG + Intronic
982602787 4:157472616-157472638 ATCCTTTAACCTTCTAAATTAGG - Intergenic
983034542 4:162847336-162847358 TTTATTTTGCCTTTTAACTTTGG - Intergenic
983077837 4:163346880-163346902 ATAGTTTAGCACTTTAAATTTGG - Intronic
983323410 4:166224592-166224614 GTAATTCTCCCTTTTAAATTGGG - Intergenic
983412072 4:167413363-167413385 ATTGTTTACCCTTTTACATTTGG - Intergenic
983823948 4:172233393-172233415 ATAATTTTACATTTTACATTTGG + Intronic
984152118 4:176146426-176146448 ATTATTTATCTTATTAAATTTGG - Intronic
984321418 4:178202018-178202040 ATAGTTTTGCATTTTACATTTGG - Intergenic
984501222 4:180561749-180561771 ATAATTTAACCTATTAACTTTGG + Intergenic
984515122 4:180728845-180728867 ATAATCTACCATTTTAAATAAGG + Intergenic
984597892 4:181692328-181692350 ATACTTTAGCCTCTTAGACTTGG - Intergenic
985308158 4:188566333-188566355 ATTATGTAGCCTTTTCAATTTGG + Intergenic
986876280 5:12114788-12114810 GTAATTTACCACTTTAAATTTGG + Intergenic
986902892 5:12458839-12458861 TTTATTTAGGCTTCTAAATTCGG - Intergenic
987636461 5:20548089-20548111 TTAGTTTTTCCTTTTAAATTAGG + Intronic
987866975 5:23554587-23554609 TTATTTTAGCTTTTTAATTTTGG - Intergenic
987925660 5:24337584-24337606 ATAATCCAGCCATTTGAATTTGG - Intergenic
988101190 5:26681010-26681032 ATAATTCAGCCTTATAAAGGAGG - Intergenic
988244270 5:28658447-28658469 ATTGCTAAGCCTTTTAAATTGGG - Intergenic
988476811 5:31593652-31593674 AAAATTTAGACTTTTACATCTGG + Intergenic
988581202 5:32470518-32470540 ATCATTTAGCCTTTAAAATAAGG - Intergenic
988859803 5:35265891-35265913 TTAATTTAGGCTTTTAATTTAGG + Intergenic
989026760 5:37076773-37076795 ATTATTTTGCCTATTTAATTTGG + Intergenic
989439944 5:41458496-41458518 ATAATTTAACTTTTTAATTTTGG - Intronic
990022436 5:51144394-51144416 AAAAATTACCTTTTTAAATTTGG + Intergenic
990166354 5:52997903-52997925 AAAACTTAGCCTTGGAAATTGGG + Intronic
990256931 5:53980458-53980480 ATAGTTTAGCGCTTAAAATTGGG - Intronic
990316192 5:54585422-54585444 ATAAAGCAGCCTTTTGAATTGGG + Intergenic
990636325 5:57731912-57731934 ATAAATTAGGCTTTTAATCTTGG + Intergenic
990782682 5:59383716-59383738 ATAATTTATATTTTTATATTTGG - Intronic
990808366 5:59692903-59692925 ATACTTTAGCCTCATAACTTTGG - Intronic
991138147 5:63207435-63207457 ATAATTTATCCATTTAATATTGG + Intergenic
992470336 5:77045899-77045921 ATAATTTTACTTTTTAAATGTGG + Intronic
993066877 5:83111994-83112016 TTAAATCAACCTTTTAAATTTGG + Intronic
993109140 5:83633759-83633781 AATATTTATCCTTTTTAATTTGG + Intergenic
993210511 5:84944575-84944597 ATTATTCAGCCTTTTAAAAAAGG - Intergenic
993388795 5:87292288-87292310 ATAGTTTTGCATTTTAATTTCGG + Intronic
993437104 5:87911262-87911284 ACAATTTCTCCCTTTAAATTTGG + Intergenic
993587442 5:89747709-89747731 ATAGTTTAGCTTTTTCATTTAGG + Intergenic
993730314 5:91414236-91414258 ATCATTCAGCCTCTTAAATGGGG + Intergenic
994072235 5:95615518-95615540 ATAATGTAGCCTTTTGTTTTTGG - Intergenic
994443770 5:99845141-99845163 ATAATTTTGACTTTTATTTTTGG + Intergenic
994782027 5:104102054-104102076 AAAATGGAGCCTTTTCAATTGGG + Intergenic
995045246 5:107639172-107639194 ATAAGTTAGAATTTTAAAATGGG + Intronic
995159352 5:108959711-108959733 ATAAATTAGGGTTTTAATTTGGG + Intronic
995203617 5:109454245-109454267 AGAATTTACCCTTTTTAATGTGG + Intergenic
995297823 5:110540561-110540583 AGAAGTTGGTCTTTTAAATTAGG - Intronic
995983426 5:118137166-118137188 AATATTTTGCCTTTTAAATTGGG + Intergenic
996210733 5:120806111-120806133 AAAATTTATTCTATTAAATTTGG - Intergenic
996283774 5:121764676-121764698 ATAAATAAGTCTTTTCAATTTGG + Intergenic
996783308 5:127212268-127212290 ATAATGCAACCTTTTAAATTAGG - Intergenic
996785840 5:127235915-127235937 ATAATTTATCCTTTTAAAGAGGG + Intergenic
996986447 5:129572006-129572028 ATAGTTTTGCATTTTACATTTGG - Intronic
997543400 5:134683910-134683932 ATAATTTAGGCCTTTTGATTTGG + Intronic
998654195 5:144157601-144157623 AGAATTTAGCATTGTACATTTGG - Intergenic
998978027 5:147669482-147669504 ATATTCAAGCCTTTTAAAATGGG - Intronic
999063387 5:148659019-148659041 TTATTTTAGCAATTTAAATTTGG - Intronic
999299008 5:150478925-150478947 AAAATTTTTCTTTTTAAATTAGG + Intergenic
999537409 5:152532320-152532342 AGATTTTAGCCTCTTAATTTTGG + Intergenic
999591787 5:153156289-153156311 ATAATTTGGCATTTTACAGTGGG - Intergenic
999820231 5:155220089-155220111 ATTATTTCTCCTTTTAAAATGGG + Intergenic
1000455151 5:161439544-161439566 ATCATTTAGCCTTTCTACTTAGG - Intronic
1001090670 5:168738003-168738025 GTAAGCTTGCCTTTTAAATTAGG + Intronic
1001261748 5:170235421-170235443 CTAATTTATACTTTTTAATTTGG - Intronic
1001779930 5:174359437-174359459 ATAATTTTTCTTTTAAAATTAGG - Intergenic
1002163149 5:177328634-177328656 AAAATTTTGCTTTTCAAATTTGG - Intergenic
1002370171 5:178745793-178745815 ATAATGTAACCTTTTAAATTAGG + Intergenic
1002867577 6:1136207-1136229 AGAAATTAGCCTTTCAACTTAGG + Intergenic
1003261378 6:4519437-4519459 AGAAATTAGTCTTTTAAACTTGG + Intergenic
1003325778 6:5089107-5089129 ACAATTTAGACTTTTAAAAATGG + Exonic
1003957981 6:11183211-11183233 ATAATTTAACTTTTTATATTAGG + Intergenic
1003963280 6:11229264-11229286 ATAATTTAGAATTTTAATGTAGG + Intronic
1004077870 6:12361784-12361806 ATAATTTGGCTTCTTAAATAAGG - Intergenic
1004589446 6:17034863-17034885 AGAATTTTCTCTTTTAAATTTGG + Intergenic
1004592146 6:17062374-17062396 ACATTTTTGCCTTTTAAATGGGG - Intergenic
1004699319 6:18064531-18064553 AAAATTCACCCTTTTAAATTTGG + Intergenic
1004974932 6:20954535-20954557 ATCATTTGGCCTTTGAAAATAGG + Intronic
1005176836 6:23056450-23056472 CTAAATTAGCCTTTTTAAATTGG + Intergenic
1005405784 6:25486420-25486442 CTAATTTAGCCTTCTATTTTGGG + Intronic
1005986698 6:30880438-30880460 ATGGTTTAGGCTTTGAAATTGGG + Intronic
1006355394 6:33553804-33553826 ATAATTCAGACTCTTAAATGTGG + Intergenic
1007051691 6:38837411-38837433 TTAATTTTTCCTTTTGAATTGGG - Intronic
1008683485 6:53899399-53899421 AGAATTTAGCTTTTCAAGTTCGG - Intronic
1008717279 6:54304416-54304438 AAAATTTAGCCTTAAAAATAAGG + Intergenic
1008795510 6:55298226-55298248 AGATCTTAGCCTTTTAATTTGGG + Intergenic
1008917312 6:56802348-56802370 GTAAGTCAACCTTTTAAATTTGG + Intronic
1009333934 6:62461343-62461365 AAAATTTAGTATTTTTAATTAGG - Intergenic
1009466454 6:63976193-63976215 GTATTTTAGCCCTTTACATTTGG - Intronic
1010145673 6:72666458-72666480 ACCACTTAGCCTATTAAATTTGG - Intronic
1010152214 6:72746305-72746327 ATAATGCAGACTTTTAAATAAGG - Intronic
1011865206 6:91816678-91816700 ATAATTTCTCTTTTTATATTTGG + Intergenic
1012011775 6:93796998-93797020 ACTATTTAGCCTTTAAAATAAGG + Intergenic
1012458504 6:99433238-99433260 ATATTTTATCATTTTATATTTGG + Exonic
1012719029 6:102717722-102717744 ATAGATTAGCATTTTAAATATGG - Intergenic
1012760651 6:103296156-103296178 ATTATTTAGCATTTTAAAAAAGG - Intergenic
1012986173 6:105878470-105878492 ACAATTTAGCCTCATAAACTTGG - Intergenic
1013673183 6:112428028-112428050 CTAATTTAGCCTATTAACTATGG - Intergenic
1014092084 6:117415489-117415511 AGAATTTTGCCTTTTAAAAGTGG - Intronic
1014241788 6:119026267-119026289 ATAATTTGGAATTTGAAATTAGG - Intronic
1014358252 6:120438954-120438976 TCAATTGAGCATTTTAAATTTGG - Intergenic
1014499554 6:122168844-122168866 ATAATTTATGTTTTTAAAATTGG - Intergenic
1014579282 6:123115126-123115148 ATAAATTAGCTTTATAAAGTTGG - Intergenic
1014868836 6:126565437-126565459 ATAATCTAGAATTTTAAAGTAGG - Intergenic
1015182952 6:130380568-130380590 TGAATTTAGCCTTTTCATTTGGG + Intronic
1015277247 6:131396558-131396580 ATAGTTTTGCATTTTACATTAGG - Intergenic
1017560844 6:155626605-155626627 ATATTTTAGCCTATGAATTTTGG - Intergenic
1019757281 7:2781363-2781385 ATGGTTTTGCCTTTCAAATTTGG + Intronic
1020466215 7:8482574-8482596 CTATTTTGGCCTTTTAAATCAGG + Intronic
1020475839 7:8593334-8593356 CTAATTTAGCTTTTTAAAGCAGG + Intronic
1020813789 7:12878990-12879012 ATAATTTATACATTTAAATGAGG + Intergenic
1020813792 7:12879035-12879057 ATAATTTATTCATTTAAATAAGG - Intergenic
1020988433 7:15165707-15165729 ATAATTTAATCTCTTAAAATGGG + Intergenic
1022061323 7:26798656-26798678 ATCATTTAGTCTTTTTACTTAGG - Intronic
1022461759 7:30615474-30615496 TTAATATAGTTTTTTAAATTAGG - Intronic
1022579979 7:31542027-31542049 ATTCTTTAGCCTTTTAATGTAGG + Intronic
1024160943 7:46675158-46675180 TTAACATAGCCCTTTAAATTGGG - Intronic
1024704837 7:51945555-51945577 TTAATTTAGCATTTTATTTTGGG - Intergenic
1024873091 7:53988888-53988910 ATAATTTAACATTTTAAAGTGGG - Intergenic
1026499662 7:70933394-70933416 ATATTTTACCCCTTAAAATTAGG - Intergenic
1026599526 7:71765529-71765551 ATAATTTAAACTTTTATTTTAGG + Intergenic
1027765974 7:82342142-82342164 ATAACCTAGCTTTTTGAATTGGG + Intronic
1027823587 7:83080734-83080756 GTAATTCAGTATTTTAAATTAGG - Intronic
1028492614 7:91429655-91429677 ATTGTTTTGCCTTTTACATTTGG - Intergenic
1028581196 7:92411312-92411334 ACAATTTGACCTTTTAACTTGGG + Intergenic
1028954767 7:96676098-96676120 ATAATTTAGCCTCATGAATTTGG - Intronic
1029000935 7:97153297-97153319 AGAATGTAGCCTTTTCAAATTGG + Intronic
1030492901 7:110260940-110260962 ATATTATAACCTTTTAAAATTGG - Intergenic
1031280459 7:119793914-119793936 ATCATTTAGTCTTTTTACTTAGG + Intergenic
1031361595 7:120855687-120855709 TTAATTTATCCTTTAAAATGGGG + Intronic
1031518753 7:122736631-122736653 CTAAATTATCCTTTTAAATCTGG - Intronic
1031801053 7:126246117-126246139 ATTTTTTAGCTTTTTAAAATCGG - Intergenic
1032314108 7:130818447-130818469 ATAATTTACCCATTTTTATTTGG + Intergenic
1032557154 7:132848281-132848303 ATAATTAAGACTTTTGAATCTGG - Intronic
1032813492 7:135447306-135447328 TTAATTTCCCCTTTTAAATTAGG + Intronic
1033536391 7:142316123-142316145 ATAATTTAACCTTTAAAACTGGG - Intergenic
1033959138 7:146891388-146891410 ATAATTTCAACTTTTACATTCGG - Intronic
1034019114 7:147621374-147621396 ATCATTTAGTCTTTTTACTTAGG - Intronic
1034507080 7:151501410-151501432 TTATTTTAGCCATTTTAATTAGG - Intronic
1034654810 7:152720925-152720947 ATAATTTATCCTTTTTATCTAGG + Intergenic
1035011554 7:155721574-155721596 ATCATACAGCCTTTAAAATTTGG - Intronic
1035902834 8:3476607-3476629 ATTATTTATCCTTGTAATTTTGG - Intronic
1035940266 8:3892198-3892220 TTAATTTAACCTTGTAAAATAGG - Intronic
1037156510 8:15706859-15706881 CTATTTTGTCCTTTTAAATTTGG + Intronic
1037348044 8:17920703-17920725 GTAATTTAGATTTTTAAAATAGG - Intergenic
1037533226 8:19799998-19800020 ATAATTTGGTATTTTAAGTTTGG - Intergenic
1038343040 8:26704781-26704803 ATAGTTTTGCATTTTATATTTGG + Intergenic
1038928682 8:32169088-32169110 ATAATTTAAGCTTCTAAAATGGG + Intronic
1039365908 8:36927827-36927849 ATATTTTGGACTTTCAAATTTGG - Intronic
1039555404 8:38471627-38471649 ATTATTTAGCCTTTTATTTGGGG - Intergenic
1039651403 8:39343029-39343051 ATAACTTAGAATTTTAATTTAGG + Intergenic
1039722876 8:40183878-40183900 AGTATATAGCCTTTTCAATTGGG - Intergenic
1040672210 8:49705207-49705229 ACAATTTAGCTTTTGAAGTTTGG - Intergenic
1040737579 8:50527847-50527869 ATATATTAGTCTTTTTAATTTGG + Intronic
1042211390 8:66384357-66384379 AGATTTTAGACTTTCAAATTTGG + Intergenic
1042365560 8:67932582-67932604 ATAAATTATTCTTTTCAATTAGG + Intergenic
1042914954 8:73866567-73866589 ATAATTCTGGCTTTTACATTTGG - Intronic
1043035166 8:75188394-75188416 ATAAATTTGCCTTTAAAAATTGG - Intergenic
1043203476 8:77405271-77405293 ATAATTCAACGTTTTAAATTAGG - Intergenic
1043786663 8:84410546-84410568 ATAATTTACCAGTTTATATTTGG - Intronic
1044022372 8:87121180-87121202 AATATTTAGCCTTTCAAGTTTGG - Intronic
1044658923 8:94576791-94576813 ATCATTTAGCCTTATAAACTAGG + Intergenic
1044806744 8:96016357-96016379 AAAATATAGCCTTTTATCTTAGG + Intergenic
1045857906 8:106785501-106785523 ATAAAATTGCTTTTTAAATTTGG + Intergenic
1045955111 8:107896830-107896852 ATAATTTTGCATTTAAAAATAGG + Intergenic
1046428685 8:114092106-114092128 ATCATGTATCCCTTTAAATTAGG + Intergenic
1046998133 8:120546793-120546815 ATAATTTAAAATTTTTAATTGGG - Intronic
1047217287 8:122886852-122886874 ATATTTGAGCCTTTTGTATTTGG + Intronic
1047560147 8:125978347-125978369 ATAATTTTTCCTTTGAACTTAGG - Intergenic
1048241488 8:132746718-132746740 ATAATTTACACATTTACATTAGG + Intronic
1048625262 8:136178347-136178369 ATATTTTAGCTTTTTTACTTCGG - Intergenic
1049892929 9:87671-87693 ATGAATTAGACTTTTAAATCAGG - Intergenic
1050814529 9:9792990-9793012 CCAATTTTGCCATTTAAATTTGG - Intronic
1051046036 9:12874720-12874742 ATAATTTTGCCTTTTGCATTTGG - Intergenic
1051139023 9:13957389-13957411 ATAACTTAGCCTTAAAATTTAGG + Intergenic
1051789184 9:20780606-20780628 ATAAATAAATCTTTTAAATTTGG - Intronic
1051947616 9:22589791-22589813 TTTTTTTAGACTTTTAAATTTGG + Intergenic
1052019077 9:23505087-23505109 ATAAATTAAGTTTTTAAATTTGG + Intergenic
1052289138 9:26822941-26822963 AGAATTTTAACTTTTAAATTTGG + Intergenic
1052314483 9:27102318-27102340 AGAATATAGCTTTTTAAATCTGG - Intergenic
1052419360 9:28222636-28222658 ATAATTGAGCCTATTTGATTTGG + Intronic
1052581642 9:30363622-30363644 ATCATTTATCCCTTTATATTTGG - Intergenic
1052656329 9:31366787-31366809 ATAATTTTGGGTTTTAAATCTGG - Intergenic
1053094620 9:35314019-35314041 ACAATTTTTCCTTTGAAATTGGG + Intronic
1053540337 9:38967264-38967286 ATAATTTAAGCTTAAAAATTAGG - Intergenic
1053734153 9:41087733-41087755 ATGAATTAGACTTTTAAATCAGG - Intergenic
1054625805 9:67396659-67396681 ATAATTTAAGCTTAAAAATTAGG + Intergenic
1055001273 9:71451531-71451553 ATAATATAACCATTAAAATTAGG + Intergenic
1055041284 9:71876114-71876136 ATATTATAGCCTTTTTAGTTTGG - Intronic
1056960548 9:91118460-91118482 AAAAGTTAGCCTTTTAAATGAGG + Intergenic
1057038354 9:91828998-91829020 ATCATTTAGCCATTTAAAATAGG - Intronic
1057078936 9:92157748-92157770 ATAATTTCTCCTTTTGAAATGGG - Intergenic
1057264802 9:93608520-93608542 ATAATTTATCCCTTTAATGTTGG + Intronic
1057363853 9:94400115-94400137 AAAATTTTGCCTTTTTATTTAGG + Intronic
1057425162 9:94942983-94943005 ATAATTTTAGCTTTTATATTTGG - Intronic
1057659481 9:96987959-96987981 AAAATTTTGCCTTTTTATTTAGG - Intronic
1057989547 9:99754021-99754043 TTATTTTATTCTTTTAAATTAGG + Intergenic
1058240771 9:102555438-102555460 ATTGTTTATCCTTTTAAAATTGG - Intergenic
1058832702 9:108833187-108833209 ATTATATAGCCTTTGAAAGTCGG + Intergenic
1059215611 9:112558946-112558968 TTAAATTAGCATTTTAAATGTGG - Intronic
1059514869 9:114883631-114883653 ATAGAATAGTCTTTTAAATTAGG + Intergenic
1059887659 9:118764583-118764605 ATCATTTAGCTTTTTAACTGTGG - Intergenic
1059984907 9:119812433-119812455 ATAATTCATCCTTTTAACCTGGG + Intergenic
1060563169 9:124565047-124565069 ATTATTTTGCCTTTGATATTTGG - Intronic
1185915196 X:4027204-4027226 ATAATTTCAACTTTTAGATTTGG - Intergenic
1186425498 X:9462102-9462124 ATAGTTTTGCCTTTTACATTTGG + Intergenic
1187573039 X:20524646-20524668 TGAATTTAGCCTTTGAAATTTGG - Intergenic
1187599340 X:20809686-20809708 ATAATTTTCCCTTTTTAAGTTGG + Intergenic
1188112774 X:26211773-26211795 ATAATTTAGGTTTTAAATTTGGG - Intergenic
1188168190 X:26888361-26888383 ATAATTTAGCACTTTATATTTGG + Intergenic
1188210841 X:27421452-27421474 ATCATTTAGCCTTTCTACTTAGG - Intergenic
1188477620 X:30603937-30603959 ATAATTTTGTCTTTTATATATGG - Intergenic
1188869008 X:35351093-35351115 ACAAAATAGCCTTTTAAATCAGG + Intergenic
1189251948 X:39607309-39607331 ATAATTTTGCCCTTAAATTTAGG - Intergenic
1189474168 X:41335900-41335922 ACAATTTTGCTTTTTAAATAAGG - Intronic
1189495533 X:41505009-41505031 ATAAATTGGACTATTAAATTTGG - Intergenic
1189572593 X:42315036-42315058 ATATTTTAGTCTTTTAAAATTGG + Intergenic
1189583945 X:42438070-42438092 ATAATTTACCCATTTATTTTAGG - Intergenic
1189645872 X:43130763-43130785 ATTTTTTACGCTTTTAAATTTGG - Intergenic
1190015363 X:46821963-46821985 ATAATTTAGTCTTTCTACTTAGG - Intergenic
1190104477 X:47549434-47549456 AAAATTTAGACTTGAAAATTAGG + Intergenic
1190614812 X:52219452-52219474 ATCATTTAGCCTTTCTACTTAGG - Intergenic
1191789025 X:64948830-64948852 ATCATTTAGCCCTTTAATCTAGG - Intronic
1192011204 X:67275691-67275713 ATCATTTAGCCTTTCTACTTAGG + Intergenic
1192427054 X:71086653-71086675 ATAATCTTGTCTTTTCAATTTGG + Intergenic
1192715406 X:73635607-73635629 AGAATTTAGCCATTTCATTTAGG + Intronic
1192908297 X:75576553-75576575 ATTATTTAGTCTTTTTACTTAGG + Intergenic
1193099934 X:77598424-77598446 ATAATTTCAACTTTTATATTCGG - Intronic
1193420651 X:81279144-81279166 ATAACACAGCCTTTTAAAATAGG - Intronic
1193499092 X:82251014-82251036 ATATTTTAAAATTTTAAATTCGG + Intergenic
1193592121 X:83402392-83402414 ATAATTTTAGCTTTTACATTAGG - Intergenic
1193653362 X:84167432-84167454 AGTATTTAGCCTTTTGGATTTGG - Intronic
1193750465 X:85336637-85336659 ATAATTTAATTTTTTAAAATGGG - Intronic
1193752752 X:85366533-85366555 ATAATTAAGGGTTTTAAAATTGG - Intronic
1193909334 X:87282193-87282215 ATAATTTAGTCTTTCTACTTAGG + Intergenic
1194079124 X:89435902-89435924 ATAATTTAGTTTTGTTAATTAGG + Intergenic
1194110841 X:89832482-89832504 CTAATTTCACCTTTTAAAATTGG + Intergenic
1194214698 X:91115308-91115330 ATAATTTATCATTTTAATTGTGG + Intergenic
1194477090 X:94371503-94371525 ATCATTTAGGCTTTTTACTTAGG - Intergenic
1194627994 X:96248353-96248375 ACAATTTTTCTTTTTAAATTAGG + Intergenic
1194846505 X:98815875-98815897 ATCATTCTGCCTTTTAAAATGGG + Intergenic
1194920982 X:99763473-99763495 ATTATTTAGTCTTTTTACTTAGG - Intergenic
1195305603 X:103580237-103580259 ATAATTAATCCTTATATATTGGG - Intronic
1195306739 X:103590844-103590866 ATAATCTAAGCTTTCAAATTAGG - Intergenic
1196093246 X:111770116-111770138 ATCTTTTAGCCTCATAAATTTGG - Intergenic
1196142465 X:112279208-112279230 CTAATTTGGCCCTTTAAATATGG - Intergenic
1196552665 X:117047205-117047227 ATGATTTAGCCTTTCTACTTAGG - Intergenic
1196883151 X:120218434-120218456 ATATAATAGCCATTTAAATTGGG - Intergenic
1197044838 X:121983009-121983031 ACTATTTAGCCTTTAAAATGAGG + Intergenic
1197106144 X:122718876-122718898 ATGATATAGCCTCTTAAAGTAGG - Intergenic
1197534317 X:127668183-127668205 ATGTTTAAGCCTATTAAATTGGG + Intergenic
1199040889 X:143114267-143114289 ATAATTTAGTCTTTCCAATTAGG + Intergenic
1199901966 X:152183922-152183944 ATAATTTTTCTTTTTAAGTTTGG + Intronic
1200463502 Y:3487219-3487241 CTAATTTCACCTTTTAAAATTGG + Intergenic
1200587109 Y:5020740-5020762 ATAAATAAGTTTTTTAAATTAGG + Intronic
1200823332 Y:7612279-7612301 ATAATTTAGCATTATGCATTTGG - Intergenic
1200878622 Y:8187578-8187600 ATAATTTAGCATTGTGCATTTGG - Intergenic
1201375888 Y:13318707-13318729 CTAATTTTGCCTTTTAAAAGGGG - Intronic
1201755327 Y:17480843-17480865 ATACTTTAGCATTTTAGAATTGG + Intergenic
1201846225 Y:18425142-18425164 ATACTTTAGCATTTTAGAATTGG - Intergenic
1202103598 Y:21337711-21337733 ATAATTTAGCCTTGATACTTAGG + Intergenic
1202236723 Y:22718816-22718838 ATAATTTAGCATTATGCATTTGG + Intergenic
1202306444 Y:23477352-23477374 ATAATTTAGCATTATGCATTTGG - Intergenic
1202564365 Y:26193237-26193259 ATAATTTAGCATTATGCATTTGG + Intergenic