ID: 1074993656

View in Genome Browser
Species Human (GRCh38)
Location 10:118735891-118735913
Sequence CTAGATAATCAGAACAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074993655_1074993656 24 Left 1074993655 10:118735844-118735866 CCAAATTTAAAAGGCTAAATTAT 0: 1
1: 0
2: 10
3: 67
4: 624
Right 1074993656 10:118735891-118735913 CTAGATAATCAGAACAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074993656 Original CRISPR CTAGATAATCAGAACAGACA AGG Intronic
No off target data available for this crispr