ID: 1074997584

View in Genome Browser
Species Human (GRCh38)
Location 10:118771104-118771126
Sequence TGTCAAATAAATATATATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074997584_1074997590 13 Left 1074997584 10:118771104-118771126 CCCCAATATATATTTATTTGACA No data
Right 1074997590 10:118771140-118771162 CCTGGCAAATATCTCTTTTGTGG No data
1074997584_1074997587 -10 Left 1074997584 10:118771104-118771126 CCCCAATATATATTTATTTGACA No data
Right 1074997587 10:118771117-118771139 TTATTTGACATAATCTGATATGG No data
1074997584_1074997591 14 Left 1074997584 10:118771104-118771126 CCCCAATATATATTTATTTGACA No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data
1074997584_1074997588 -5 Left 1074997584 10:118771104-118771126 CCCCAATATATATTTATTTGACA No data
Right 1074997588 10:118771122-118771144 TGACATAATCTGATATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074997584 Original CRISPR TGTCAAATAAATATATATTG GGG (reversed) Intergenic
No off target data available for this crispr