ID: 1074997585

View in Genome Browser
Species Human (GRCh38)
Location 10:118771105-118771127
Sequence ATGTCAAATAAATATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074997585_1074997590 12 Left 1074997585 10:118771105-118771127 CCCAATATATATTTATTTGACAT No data
Right 1074997590 10:118771140-118771162 CCTGGCAAATATCTCTTTTGTGG No data
1074997585_1074997591 13 Left 1074997585 10:118771105-118771127 CCCAATATATATTTATTTGACAT No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data
1074997585_1074997588 -6 Left 1074997585 10:118771105-118771127 CCCAATATATATTTATTTGACAT No data
Right 1074997588 10:118771122-118771144 TGACATAATCTGATATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074997585 Original CRISPR ATGTCAAATAAATATATATT GGG (reversed) Intergenic
No off target data available for this crispr