ID: 1074997586

View in Genome Browser
Species Human (GRCh38)
Location 10:118771106-118771128
Sequence TATGTCAAATAAATATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074997586_1074997588 -7 Left 1074997586 10:118771106-118771128 CCAATATATATTTATTTGACATA No data
Right 1074997588 10:118771122-118771144 TGACATAATCTGATATGGCCTGG No data
1074997586_1074997591 12 Left 1074997586 10:118771106-118771128 CCAATATATATTTATTTGACATA No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data
1074997586_1074997590 11 Left 1074997586 10:118771106-118771128 CCAATATATATTTATTTGACATA No data
Right 1074997590 10:118771140-118771162 CCTGGCAAATATCTCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074997586 Original CRISPR TATGTCAAATAAATATATAT TGG (reversed) Intergenic
No off target data available for this crispr