ID: 1074997591

View in Genome Browser
Species Human (GRCh38)
Location 10:118771141-118771163
Sequence CTGGCAAATATCTCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074997584_1074997591 14 Left 1074997584 10:118771104-118771126 CCCCAATATATATTTATTTGACA No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data
1074997585_1074997591 13 Left 1074997585 10:118771105-118771127 CCCAATATATATTTATTTGACAT No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data
1074997586_1074997591 12 Left 1074997586 10:118771106-118771128 CCAATATATATTTATTTGACATA No data
Right 1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074997591 Original CRISPR CTGGCAAATATCTCTTTTGT GGG Intergenic
No off target data available for this crispr