ID: 1074999609

View in Genome Browser
Species Human (GRCh38)
Location 10:118785763-118785785
Sequence GCCTTGAATGCTCTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074999609_1074999611 -6 Left 1074999609 10:118785763-118785785 CCACATCACAGAGCATTCAAGGC No data
Right 1074999611 10:118785780-118785802 CAAGGCTGCACCTGTGCCATGGG No data
1074999609_1074999616 14 Left 1074999609 10:118785763-118785785 CCACATCACAGAGCATTCAAGGC No data
Right 1074999616 10:118785800-118785822 GGGTGGCAAAGGAGCCTCTGAGG No data
1074999609_1074999610 -7 Left 1074999609 10:118785763-118785785 CCACATCACAGAGCATTCAAGGC No data
Right 1074999610 10:118785779-118785801 TCAAGGCTGCACCTGTGCCATGG No data
1074999609_1074999613 3 Left 1074999609 10:118785763-118785785 CCACATCACAGAGCATTCAAGGC No data
Right 1074999613 10:118785789-118785811 ACCTGTGCCATGGGTGGCAAAGG No data
1074999609_1074999612 -3 Left 1074999609 10:118785763-118785785 CCACATCACAGAGCATTCAAGGC No data
Right 1074999612 10:118785783-118785805 GGCTGCACCTGTGCCATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074999609 Original CRISPR GCCTTGAATGCTCTGTGATG TGG (reversed) Intergenic
No off target data available for this crispr