ID: 1075001001

View in Genome Browser
Species Human (GRCh38)
Location 10:118797669-118797691
Sequence GATCCTTTCCCCAGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075000997_1075001001 30 Left 1075000997 10:118797616-118797638 CCAGGGCTCTACTATGTTAGGAA No data
Right 1075001001 10:118797669-118797691 GATCCTTTCCCCAGTGAAATGGG No data
1075000999_1075001001 -4 Left 1075000999 10:118797650-118797672 CCTCTCTATATGACTCTTTGATC No data
Right 1075001001 10:118797669-118797691 GATCCTTTCCCCAGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075001001 Original CRISPR GATCCTTTCCCCAGTGAAAT GGG Intergenic
No off target data available for this crispr