ID: 1075001478

View in Genome Browser
Species Human (GRCh38)
Location 10:118801958-118801980
Sequence CAAATTAGGAAAAGTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075001478_1075001482 21 Left 1075001478 10:118801958-118801980 CCTCCTTCACTTTTCCTAATTTG No data
Right 1075001482 10:118802002-118802024 GCCTTTTTTTTTTTTTGAGACGG 0: 98
1: 1597
2: 15782
3: 118281
4: 84202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075001478 Original CRISPR CAAATTAGGAAAAGTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr