ID: 1075004188

View in Genome Browser
Species Human (GRCh38)
Location 10:118818704-118818726
Sequence CTCCTCACTGCTCCGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075004182_1075004188 15 Left 1075004182 10:118818666-118818688 CCATAGCCATGGTCAAGTGCCTT No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004183_1075004188 9 Left 1075004183 10:118818672-118818694 CCATGGTCAAGTGCCTTCTGTTT No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004181_1075004188 16 Left 1075004181 10:118818665-118818687 CCCATAGCCATGGTCAAGTGCCT No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004178_1075004188 21 Left 1075004178 10:118818660-118818682 CCCTCCCCATAGCCATGGTCAAG No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004179_1075004188 20 Left 1075004179 10:118818661-118818683 CCTCCCCATAGCCATGGTCAAGT No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004176_1075004188 28 Left 1075004176 10:118818653-118818675 CCTGGAGCCCTCCCCATAGCCAT No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004186_1075004188 -4 Left 1075004186 10:118818685-118818707 CCTTCTGTTTGGCTGGCCTCTCC No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data
1075004180_1075004188 17 Left 1075004180 10:118818664-118818686 CCCCATAGCCATGGTCAAGTGCC No data
Right 1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075004188 Original CRISPR CTCCTCACTGCTCCGTGCCC AGG Intergenic
No off target data available for this crispr