ID: 1075005010

View in Genome Browser
Species Human (GRCh38)
Location 10:118823809-118823831
Sequence CTGTGTTTATGGAGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075005002_1075005010 18 Left 1075005002 10:118823768-118823790 CCCTTGGAAGGCTTGATGTCATC No data
Right 1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG No data
1075005003_1075005010 17 Left 1075005003 10:118823769-118823791 CCTTGGAAGGCTTGATGTCATCA No data
Right 1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075005010 Original CRISPR CTGTGTTTATGGAGAGGGGC TGG Intergenic
No off target data available for this crispr