ID: 1075006996

View in Genome Browser
Species Human (GRCh38)
Location 10:118838316-118838338
Sequence TTGTTTCAACAGAGACCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075006995_1075006996 10 Left 1075006995 10:118838283-118838305 CCATAGCTATGGTGCTACAACAG No data
Right 1075006996 10:118838316-118838338 TTGTTTCAACAGAGACCATGTGG No data
1075006993_1075006996 26 Left 1075006993 10:118838267-118838289 CCAATTTACATGTTCTCCATAGC No data
Right 1075006996 10:118838316-118838338 TTGTTTCAACAGAGACCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075006996 Original CRISPR TTGTTTCAACAGAGACCATG TGG Intergenic
No off target data available for this crispr