ID: 1075007260

View in Genome Browser
Species Human (GRCh38)
Location 10:118839942-118839964
Sequence TACCCCACTGGGTTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075007260_1075007264 -3 Left 1075007260 10:118839942-118839964 CCCAGGGAAAACCCAGTGGGGTA No data
Right 1075007264 10:118839962-118839984 GTAGCCCCCAGTTCTTCAGATGG No data
1075007260_1075007266 1 Left 1075007260 10:118839942-118839964 CCCAGGGAAAACCCAGTGGGGTA No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007260_1075007270 29 Left 1075007260 10:118839942-118839964 CCCAGGGAAAACCCAGTGGGGTA No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075007260 Original CRISPR TACCCCACTGGGTTTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr