ID: 1075007266

View in Genome Browser
Species Human (GRCh38)
Location 10:118839966-118839988
Sequence CCCCCAGTTCTTCAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075007254_1075007266 13 Left 1075007254 10:118839930-118839952 CCACTCCCATGTCCCAGGGAAAA No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007261_1075007266 0 Left 1075007261 10:118839943-118839965 CCAGGGAAAACCCAGTGGGGTAG No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007262_1075007266 -10 Left 1075007262 10:118839953-118839975 CCCAGTGGGGTAGCCCCCAGTTC No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007260_1075007266 1 Left 1075007260 10:118839942-118839964 CCCAGGGAAAACCCAGTGGGGTA No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007256_1075007266 7 Left 1075007256 10:118839936-118839958 CCATGTCCCAGGGAAAACCCAGT No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007251_1075007266 27 Left 1075007251 10:118839916-118839938 CCTTGTGTTTCTCACCACTCCCA No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
1075007255_1075007266 8 Left 1075007255 10:118839935-118839957 CCCATGTCCCAGGGAAAACCCAG No data
Right 1075007266 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075007266 Original CRISPR CCCCCAGTTCTTCAGATGGA AGG Intergenic