ID: 1075007270

View in Genome Browser
Species Human (GRCh38)
Location 10:118839994-118840016
Sequence GTTCGATACACGACCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075007268_1075007270 3 Left 1075007268 10:118839968-118839990 CCCAGTTCTTCAGATGGAAGGCG No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007267_1075007270 4 Left 1075007267 10:118839967-118839989 CCCCAGTTCTTCAGATGGAAGGC No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007263_1075007270 17 Left 1075007263 10:118839954-118839976 CCAGTGGGGTAGCCCCCAGTTCT No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007262_1075007270 18 Left 1075007262 10:118839953-118839975 CCCAGTGGGGTAGCCCCCAGTTC No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007261_1075007270 28 Left 1075007261 10:118839943-118839965 CCAGGGAAAACCCAGTGGGGTAG No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007265_1075007270 5 Left 1075007265 10:118839966-118839988 CCCCCAGTTCTTCAGATGGAAGG No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007260_1075007270 29 Left 1075007260 10:118839942-118839964 CCCAGGGAAAACCCAGTGGGGTA No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data
1075007269_1075007270 2 Left 1075007269 10:118839969-118839991 CCAGTTCTTCAGATGGAAGGCGC No data
Right 1075007270 10:118839994-118840016 GTTCGATACACGACCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075007270 Original CRISPR GTTCGATACACGACCATGAC AGG Intergenic