ID: 1075007601

View in Genome Browser
Species Human (GRCh38)
Location 10:118842110-118842132
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 4, 1: 5, 2: 23, 3: 85, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075007601_1075007609 -10 Left 1075007601 10:118842110-118842132 CCAGCCCCTTCCAAGTTGGGGTG 0: 4
1: 5
2: 23
3: 85
4: 370
Right 1075007609 10:118842123-118842145 AGTTGGGGTGGGAGCTCCCTGGG 0: 7
1: 12
2: 57
3: 59
4: 315
1075007601_1075007616 29 Left 1075007601 10:118842110-118842132 CCAGCCCCTTCCAAGTTGGGGTG 0: 4
1: 5
2: 23
3: 85
4: 370
Right 1075007616 10:118842162-118842184 CAAGCCACGGCTGCTGACCCAGG No data
1075007601_1075007612 16 Left 1075007601 10:118842110-118842132 CCAGCCCCTTCCAAGTTGGGGTG 0: 4
1: 5
2: 23
3: 85
4: 370
Right 1075007612 10:118842149-118842171 TGCTGCAGCCGCCCAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075007601 Original CRISPR CACCCCAACTTGGAAGGGGC TGG (reversed) Intergenic
900165012 1:1241059-1241081 CACGCCAACCAGGAAGGTGCAGG + Intergenic
901691042 1:10973671-10973693 CGTCCCAACTCAGAAGGGGCGGG - Intronic
901759698 1:11462729-11462751 CACCCCAGCTGGGAAGGAGGAGG - Intergenic
902178427 1:14669166-14669188 CACCCCAACTTGGGAAGCCCTGG + Intronic
902644892 1:17791193-17791215 TGCCCCAACTCGGAAGGGGCAGG + Intronic
903082215 1:20820028-20820050 CATCCCAACTCAGAAGGGGCAGG - Intronic
903672263 1:25043384-25043406 CGCCCCAACTCAGAAGGGGGTGG + Intergenic
903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG + Intergenic
904369941 1:30042090-30042112 CCCACCAACTCTGAAGGGGCAGG - Intergenic
904484542 1:30816179-30816201 CCCTCCACCTTGGCAGGGGCAGG - Intergenic
904533217 1:31182352-31182374 GACCCCAGCCTGGAACGGGCTGG + Intronic
905038115 1:34930184-34930206 CGCCCCATCCTGGCAGGGGCTGG - Intergenic
905477447 1:38239000-38239022 CACGCCAAGGTGGAAGGAGCTGG + Intergenic
905792732 1:40798936-40798958 GACCCCAACAAGGGAGGGGCTGG - Intronic
905930646 1:41784616-41784638 CACCCCAAACTGTGAGGGGCTGG + Intronic
906448389 1:45922744-45922766 CCCACCAACTCGGAAGGGGTGGG + Intronic
907152837 1:52305607-52305629 CCCACCAACTCGGAAGGGGTGGG - Intronic
907369776 1:53993151-53993173 CCCACCAACTTGGAAGGGACAGG + Intergenic
909197649 1:72648345-72648367 CCCACCAACTTGGAAGGGGGTGG - Intergenic
911275406 1:95853179-95853201 CCCACCAACTTGGAAGGGGTGGG - Intergenic
911539934 1:99146342-99146364 CACTCCAACTTGGATGGGGCGGG - Intergenic
911910403 1:103627660-103627682 CAACCCATCTTGGAACGGGTTGG - Intergenic
911917821 1:103721785-103721807 CAACCCATCTTGGAACGGGTTGG - Intronic
912132382 1:106619273-106619295 CCGCCCAACTTGGAAGGGGTCGG - Intergenic
915454343 1:156029545-156029567 CACCCCAAGTTGAAAGTGGATGG + Intergenic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
915838894 1:159199899-159199921 CAGCAGAACTTGGGAGGGGCAGG + Intronic
916648923 1:166816906-166816928 CCTGCCAACTAGGAAGGGGCAGG + Intergenic
916784818 1:168078981-168079003 CACCCAATCTTGGAAGCAGCTGG - Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918114895 1:181487324-181487346 CACCCCGACTTGGAGGGGGAGGG + Intronic
919025318 1:192161659-192161681 AACCTCATCTTGGAAGGGTCTGG - Intronic
919165447 1:193885644-193885666 TATCCCAACTCAGAAGGGGCAGG + Intergenic
919191914 1:194230967-194230989 CACCCCAACTCAGAAGGGGCGGG + Intergenic
920269405 1:204752048-204752070 CGTCCCAACTCAGAAGGGGCGGG - Intergenic
921902167 1:220462899-220462921 CATCCCAACTCAGAAGGGGCGGG - Intergenic
921902226 1:220463181-220463203 CCCACCAACTTGGAAGGGACAGG - Intergenic
922642263 1:227245876-227245898 CACCACAACTGGGAATGTGCTGG - Intronic
923391235 1:233515675-233515697 CCCACCAACTAGAAAGGGGCAGG - Intergenic
923755159 1:236785389-236785411 CTCACCAACTCAGAAGGGGCAGG - Intergenic
923823485 1:237473629-237473651 GACCCAAACTAGGAAGGAGCGGG + Intronic
924493997 1:244568686-244568708 CACCCGAACTTGGTGGGGGTAGG - Intronic
1062771649 10:105535-105557 TGCCCCAACTTGGAAGGGGTAGG + Intergenic
1064748711 10:18503510-18503532 CACTTCAACTTGGAAGGCGGAGG + Intronic
1068060789 10:52064733-52064755 CATCCCAACTCAGAAGGGGTGGG + Intronic
1068967242 10:62924718-62924740 CGCCCCAACTCAGAAGGGGCGGG + Intergenic
1069356706 10:67595026-67595048 CACAGCAACTTGGATGGAGCTGG - Intronic
1069576069 10:69529242-69529264 CACCGCAACTCAGAAGGAGCAGG + Intergenic
1069624169 10:69857190-69857212 GACCCCAACCTGGAAGCGACAGG + Intronic
1069724479 10:70568521-70568543 CACCCTTACTCTGAAGGGGCAGG - Intergenic
1070740955 10:78902978-78903000 CAGCACAACTTGGGAGGGCCGGG - Intergenic
1070793984 10:79206364-79206386 CACACCAAATTAGCAGGGGCAGG - Intronic
1070862593 10:79684618-79684640 CAGCCCAACTTGGAGGTGCCCGG + Intergenic
1071886183 10:89952434-89952456 TGCCTCAATTTGGAAGGGGCAGG + Intergenic
1072335697 10:94395959-94395981 CACCCCAGCTCAGAAGGGGTGGG + Intergenic
1072470371 10:95707378-95707400 CACCCCAATTCAGAAAGGGCAGG + Intergenic
1073476047 10:103754583-103754605 CACCCCATCTTGGAAGGGAGGGG + Intronic
1074782934 10:116815173-116815195 GACCCAAAGTTGGAAGAGGCTGG - Intergenic
1075007601 10:118842110-118842132 CACCCCAACTTGGAAGGGGCTGG - Intergenic
1075023338 10:118966978-118967000 CAACCCACCTAGGATGGGGCAGG - Intergenic
1076655431 10:132020445-132020467 CACCAAAACTTGGAAGCTGCTGG - Intergenic
1078042899 11:7884569-7884591 AACCCCAACTCGGAACAGGCAGG + Intergenic
1079472451 11:20790783-20790805 TACCCCAACTTGGAAGGGGCGGG + Intronic
1080652525 11:34234147-34234169 CACCCCAACAGGGGAGGGGAGGG - Intronic
1081862020 11:46338746-46338768 TTACCCAACTAGGAAGGGGCAGG - Intronic
1082082178 11:48020772-48020794 CATCCAAACGTGGGAGGGGCAGG - Intronic
1082750196 11:57006454-57006476 CACCCTAATTCGAAAGGGGCAGG + Intergenic
1082998342 11:59270139-59270161 GACCCCAAGTTGGAAGGAGAGGG + Intergenic
1083060867 11:59869759-59869781 CACAGCAACTTGGATGGAGCTGG + Intergenic
1084991014 11:72925807-72925829 CGTCCCAACTCAGAAGGGGCAGG - Intronic
1085100451 11:73796117-73796139 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1085178434 11:74511179-74511201 CACCACAGCTGGGAAGGTGCTGG - Intronic
1085299100 11:75448153-75448175 CACCCCCACTTGGCAGGGTGGGG + Intronic
1085706503 11:78791018-78791040 CAACCCAGCTTGTAAAGGGCTGG - Intronic
1086382734 11:86274654-86274676 CACCCTAGCTGGGAAGGGCCAGG + Intronic
1087036102 11:93758232-93758254 AGCGCCAACTCGGAAGGGGCAGG - Intronic
1087844366 11:102955627-102955649 CACCACCACTGGGAAGGGGCAGG + Exonic
1088291364 11:108241858-108241880 CACAGCTACTTGGAAGGGGGTGG - Intronic
1088513092 11:110598777-110598799 CACCCCAACTCAGAAGGGGCAGG - Intronic
1089505949 11:118961855-118961877 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1089529988 11:119121471-119121493 CACCAAAACACGGAAGGGGCGGG - Intergenic
1089782186 11:120881509-120881531 CAACCCAGCTTTCAAGGGGCTGG + Intronic
1089823017 11:121246084-121246106 CGCCTCAACTCAGAAGGGGCGGG - Intergenic
1089823076 11:121246317-121246339 CCCGCCAACTTGGAAGGAGTGGG - Intergenic
1090137124 11:124210062-124210084 CCTGCCAGCTTGGAAGGGGCCGG + Intergenic
1090339423 11:126003456-126003478 GACCCCAAAATGGAAGGGGGAGG + Intronic
1090868842 11:130725320-130725342 CACCCTAACTTGCATGGGGTAGG + Intergenic
1095042174 12:37455432-37455454 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1095978632 12:47957415-47957437 GACTCCAACTTGGTGGGGGCAGG + Intergenic
1096602775 12:52742233-52742255 CCCACCAACTTGGAAGGGGCGGG - Intergenic
1096876017 12:54631129-54631151 TTCCCCACCTTGGCAGGGGCAGG + Intronic
1096877923 12:54644940-54644962 TTCCCCACCTTGGCAGGGGCAGG + Intronic
1097008121 12:55933324-55933346 CGCCCCAATTGGGTAGGGGCGGG + Intronic
1097078299 12:56410987-56411009 CATCCCAACTCAGAAGGGACAGG + Intergenic
1097078684 12:56413505-56413527 CCCGCCAACTTGAAAGGGGGCGG + Intergenic
1097536243 12:60873420-60873442 CCCTCCAACGTGGAAGGGGACGG + Intergenic
1097938501 12:65278914-65278936 CACCCTAACGTGGCAGGGTCGGG - Intronic
1098465808 12:70784276-70784298 CCTGCCAACTTGGAAGGGGCAGG + Intronic
1098597996 12:72295256-72295278 CACCCCAGCTCAGAAGGGGCAGG + Intronic
1099033619 12:77559590-77559612 CCCGCCAACTTAGAAGGGGATGG - Intergenic
1099295223 12:80821707-80821729 CCCTCCAATTTGGAAGGGGTGGG - Intronic
1099911936 12:88844651-88844673 CACCCCAACTCAAAAGGGGTGGG + Intergenic
1100593760 12:96053997-96054019 CAACTCAACTTGGAACAGGCAGG + Intergenic
1101394176 12:104329563-104329585 CACCCGAACTTGGGAGGTGAAGG + Intronic
1101764074 12:107682521-107682543 CCCGCCAACTTGGGAGGGGCAGG + Intergenic
1101764135 12:107682790-107682812 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
1101842447 12:108337897-108337919 CAAACCAGTTTGGAAGGGGCAGG + Intronic
1103970642 12:124668880-124668902 CACCAGAAGCTGGAAGGGGCCGG + Intergenic
1105424373 13:20282497-20282519 CCCGCCATCTTGGAAGAGGCAGG - Intergenic
1105436226 13:20380618-20380640 CACCAGAACCTGGAAGAGGCAGG + Intergenic
1105640034 13:22252704-22252726 CCCACCAACTCTGAAGGGGCGGG - Intergenic
1106379416 13:29222649-29222671 CCCTCCAACTTGGAAGGGGTGGG - Intronic
1106620187 13:31365019-31365041 CCCGCCAACTTAGAAGAGGCAGG - Intergenic
1107234840 13:38155619-38155641 CACCCCAACATGGTAGGGATGGG + Intergenic
1107513431 13:41107268-41107290 CATCCCAACTTAGAAGGGGCCGG - Intergenic
1107659240 13:42622347-42622369 CACAGCAACTTGGATGGAGCTGG + Intergenic
1108240471 13:48458083-48458105 TGTCCCAACTCGGAAGGGGCGGG + Intronic
1110999987 13:82165767-82165789 CCTGCCAACTCGGAAGGGGCGGG + Intergenic
1111360496 13:87168610-87168632 CCTGCCAACTTGGAAGGGGGTGG + Intergenic
1111512814 13:89287908-89287930 CACCCCTACTCAGAAGTGGCAGG + Intergenic
1112040950 13:95547321-95547343 AATGCCAACATGGAAGGGGCTGG - Intronic
1112137386 13:96596242-96596264 CACAGCAACTTGGATGGAGCTGG - Intronic
1112847050 13:103656340-103656362 TACCCCAGTTTGGAAGGGGTGGG - Intergenic
1113339035 13:109404362-109404384 CGCCCCAACTCAGAAGGGGCAGG - Intergenic
1115325013 14:32128412-32128434 CACACCAACTTGCAAGGGCGTGG + Intronic
1116257109 14:42570921-42570943 CACTCCAACTCAGAAGGGGCAGG - Intergenic
1117233969 14:53752286-53752308 CACCACAACTGGGAATGTGCTGG - Intergenic
1119618081 14:76111891-76111913 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1121054183 14:90839435-90839457 AGCCCAGACTTGGAAGGGGCAGG - Intergenic
1121363007 14:93279426-93279448 GACCCCAATATGGAAGGGGAGGG - Intronic
1123781654 15:23634323-23634345 CACCCCAGCAGGGAAGGTGCAGG - Intergenic
1124022442 15:25937141-25937163 ACCCCCAACATGGAAGGTGCAGG + Intergenic
1124650338 15:31469363-31469385 CCCACCAACTTGGAAGGGGCGGG + Intergenic
1124937479 15:34186555-34186577 CCCACCAATTTGGAAGAGGCAGG - Intronic
1125241447 15:37581971-37581993 CCCTCCAACTTGGAAGCGGGCGG - Intergenic
1125381748 15:39093076-39093098 CACCCCAACTTAGAAGGGGCAGG + Intergenic
1125717972 15:41830486-41830508 TCCACCAACTTGGAAGGGGTGGG - Intronic
1126215106 15:46145906-46145928 CCCTCCAACTTAGAAGGGGATGG - Intergenic
1126257426 15:46644107-46644129 CAGCACAGCTTTGAAGGGGCAGG + Intergenic
1126292771 15:47100090-47100112 CATTCCAACTCGGAAGGGGCAGG + Intergenic
1126990961 15:54374708-54374730 TCCTCCAACTTGGAAGGGGTGGG + Intronic
1127526072 15:59792672-59792694 CACCCCGACTTGGGAGGGGAGGG + Intergenic
1127872190 15:63082939-63082961 CCCCACACCTTGGAAGGGGAGGG + Intergenic
1128147106 15:65337792-65337814 CTCCCCATCTTCGAAGGAGCAGG - Intronic
1128235544 15:66064942-66064964 CACCCCAACCTGGGAGTGTCTGG + Intronic
1128638767 15:69320053-69320075 CACCCCAACGGGGAAGGCTCTGG - Intronic
1128847732 15:70916726-70916748 CGCCCCAACTCGGAAGGGGCAGG - Intronic
1129183428 15:73891496-73891518 CCCTCCAACTTGGAAGGGGGCGG - Intergenic
1129206256 15:74038650-74038672 CTCCCCAGCTTGGAGGGGGTGGG + Intronic
1129784911 15:78303816-78303838 CTCCCCAACTCAGAAGGGGGAGG - Intergenic
1130183029 15:81651182-81651204 CACCCCAAGTCAGAAAGGGCAGG - Intergenic
1132259523 15:100410127-100410149 CACTCCACGTTGGAAGGGGATGG + Intronic
1135208133 16:20499719-20499741 CTCACCAACTTAGAAGGGGTGGG - Intergenic
1135210766 16:20523981-20524003 CTCACCAACTTAGAAGGGGTGGG + Intergenic
1135982585 16:27159773-27159795 CACCTCAACTTCTAGGGGGCAGG + Intergenic
1137291611 16:47055495-47055517 CCCACCAACCTGGAAGGGGCAGG + Intergenic
1137334509 16:47534076-47534098 CACCCAAGCTCGGAAGGGGTGGG + Intronic
1137698587 16:50479045-50479067 CTTCCCAACTCAGAAGGGGCGGG + Intergenic
1138593310 16:58015218-58015240 CACCACAACTGGGATGGAGCTGG - Intronic
1138844945 16:60554262-60554284 CACCACAACTAGGAATGTGCTGG + Intergenic
1139663943 16:68442924-68442946 AGCCCCAGCTTGGAAGGGGAAGG + Intronic
1139952989 16:70680925-70680947 CACCCCAGCAGGGGAGGGGCAGG - Intronic
1140498293 16:75409353-75409375 GGCCCACACTTGGAAGGGGCAGG + Intronic
1142285284 16:89169077-89169099 CACCCCAACCACTAAGGGGCAGG - Intergenic
1142415142 16:89937017-89937039 ACCCCCAACATGGATGGGGCCGG + Intergenic
1142940800 17:3378555-3378577 CTCACCAACTTGGTAGGGGGTGG + Intergenic
1143844834 17:9766246-9766268 CACCCCTTCCTGGAAGTGGCTGG - Intergenic
1144108423 17:12008113-12008135 AACCCCATCTTGGAAGAGGCTGG + Intergenic
1144386200 17:14751262-14751284 CTCGCCAACCTGGAAGGGGCAGG - Intergenic
1144437326 17:15253595-15253617 CACCCCCACTAGGAAGGAGTTGG - Intronic
1144695358 17:17300822-17300844 CCCGCCAACTCAGAAGGGGCGGG - Intergenic
1144714364 17:17424022-17424044 CCCACCAACTCAGAAGGGGCGGG - Intergenic
1145094191 17:20009938-20009960 CACCCCGGCCAGGAAGGGGCGGG - Intronic
1145368493 17:22286720-22286742 CCTGGCAACTTGGAAGGGGCTGG - Intergenic
1145798281 17:27668292-27668314 AACCCCAGCCTGGAAGGGCCAGG - Intergenic
1146008955 17:29179458-29179480 CACCCCCACTAACAAGGGGCAGG + Intronic
1146425163 17:32731710-32731732 CCAGCCAACTTGGAAGGGGGCGG - Intronic
1146459353 17:33033440-33033462 CCTGCCAACTTGGAAGGGGCAGG - Intronic
1146761412 17:35482425-35482447 CGTCCCAACTTGGAAGAGGCAGG - Intronic
1146912611 17:36658196-36658218 CCCCCCAAATAGGAAGGGGTCGG - Intergenic
1147178459 17:38671125-38671147 CAACTCAACCTGGAAGGGGGCGG - Intergenic
1148134859 17:45285540-45285562 CACTTGAACTTGGAAGGGGGAGG + Intronic
1148386415 17:47237971-47237993 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1148441579 17:47714281-47714303 CATCCTAGCTGGGAAGGGGCGGG + Intergenic
1148640520 17:49183921-49183943 CCCGCTAACTTGGAAGAGGCAGG + Intergenic
1149160521 17:53687266-53687288 CCCACCAACTCAGAAGGGGCAGG + Intergenic
1149362609 17:55911032-55911054 CCCACCAACTTAGAAGGGGTGGG + Intergenic
1149685556 17:58532544-58532566 CACCCGAGCTGTGAAGGGGCAGG + Intronic
1150008635 17:61485677-61485699 CACCCTAGATTGGAAGAGGCAGG + Intergenic
1150168347 17:62966171-62966193 CACCCCAGCCCGGAGGGGGCGGG + Intergenic
1150950776 17:69800963-69800985 CGCCCCAACTTGGAAGGGGTGGG - Intergenic
1151395482 17:73820017-73820039 CCCACCAACTTGGAAGGGGCAGG + Intergenic
1151968760 17:77446235-77446257 CACCCAAAGCTGGAAGAGGCAGG - Intronic
1152684135 17:81685526-81685548 CACCCCAGCTTGGCAGCAGCTGG - Intronic
1153428088 18:4988060-4988082 CCCACCAACTTGGAAGGAGGAGG + Intergenic
1153672692 18:7427705-7427727 CACCCCAACGTGGAGCCGGCTGG + Intergenic
1154056541 18:11018101-11018123 TACCCAAAGCTGGAAGGGGCAGG - Intronic
1154230636 18:12553135-12553157 CACCACAGCGGGGAAGGGGCTGG - Intronic
1154505835 18:15040167-15040189 CCCTGCAACTTGGAAGGGGAAGG + Intergenic
1154507852 18:15060545-15060567 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1156244582 18:35284991-35285013 CCCGCCAACTTGGAAGGAGCTGG + Intronic
1157289067 18:46397157-46397179 CACTCCAACTTGGAGGAGGAGGG + Intronic
1159186567 18:64983570-64983592 CACCCCAACTTGGAAGAGGTAGG - Intergenic
1159519241 18:69496344-69496366 CCCACCAACTCGGAAGGGGCGGG + Intronic
1160083690 18:75754288-75754310 CCCACCAACTTGGATGGGGGAGG + Intergenic
1161056225 19:2191771-2191793 AGCCCCAACCTGGGAGGGGCAGG - Intronic
1161493448 19:4575255-4575277 AACCCCAACTTGGAGGGGAAGGG - Intergenic
1161780035 19:6285922-6285944 CACCCCAATGCAGAAGGGGCGGG - Intergenic
1161781677 19:6297337-6297359 CATCCCAACTCAGGAGGGGCGGG - Intergenic
1163837063 19:19581522-19581544 CACTGCCACTTGGAAGGAGCCGG + Intronic
1164489124 19:28690567-28690589 CACCCCAATGGGGAGGGGGCAGG - Intergenic
1164503573 19:28839758-28839780 CACCTCAACTTGGAAGCAACGGG + Intergenic
1165022498 19:32935988-32936010 CCCACCAACTCAGAAGGGGCAGG - Intronic
1165027047 19:32969691-32969713 CCCGCCAACTTGGAAGAGGCAGG + Intronic
1165476529 19:36033888-36033910 CATCCCAGCCTGGATGGGGCTGG + Intergenic
1166897293 19:46032184-46032206 CCCACCAACTTGGAAGGGGCAGG - Intergenic
1167013022 19:46821543-46821565 CACCACAGCTCAGAAGGGGCAGG - Intergenic
1167234925 19:48308658-48308680 CATCCCAACTCAGAAGGGTCAGG - Intronic
1167234992 19:48308951-48308973 CCCACCAACTCGGAAGGGGCAGG - Intronic
1167346082 19:48946551-48946573 CTCCTGATCTTGGAAGGGGCAGG - Intergenic
1168084410 19:54034816-54034838 CGCCCCAACTCGGAAGGGGCAGG - Intergenic
1168303275 19:55419293-55419315 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
925573362 2:5334738-5334760 CACTCCAACCTGGCAGGGGAAGG + Intergenic
926859416 2:17292370-17292392 CACCCCAACTCAGAAGGGGCAGG + Intergenic
927287565 2:21372387-21372409 CAGCAGTACTTGGAAGGGGCAGG - Intergenic
927469922 2:23366020-23366042 AACAGCAACTTGGATGGGGCTGG + Intergenic
928470392 2:31569103-31569125 CCCACCAACTTGGTAGGGGATGG + Intronic
930599038 2:53423282-53423304 CTCCCCAACTTGGGAGCTGCAGG + Intergenic
930971292 2:57398099-57398121 CCCTCCAACTTGGCAGGGGCGGG + Intergenic
931499903 2:62854867-62854889 AGCCCCAACTCAGAAGGGGCGGG - Intronic
931985433 2:67737137-67737159 CACAACAACTTGGATGGAGCTGG + Intergenic
932134279 2:69214675-69214697 TACCCCTCCTTGGTAGGGGCAGG + Intronic
932307042 2:70711438-70711460 CTCCCCACTTTGGAAGTGGCGGG - Intronic
932398386 2:71463455-71463477 CCCACCAACTTGGTAGGGGGCGG + Intronic
933219353 2:79670157-79670179 CCTGCCAACTTGGAAGAGGCAGG + Intronic
934766374 2:96882381-96882403 CCCTCCAACGTGGCAGGGGCAGG + Intronic
934991718 2:98926356-98926378 CACCTCAACTGAGAGGGGGCTGG + Intronic
936511193 2:113149045-113149067 CACCACAACTTGGAATGCACTGG + Intergenic
937250644 2:120521695-120521717 AACCCCAAGCTGCAAGGGGCAGG - Intergenic
938096560 2:128467682-128467704 CCCACCAACTTGTAAGGGGCAGG + Intergenic
938169079 2:129058864-129058886 CACACAAACTTGGAACGGCCAGG + Intergenic
938656105 2:133435831-133435853 AACCCCGACATGGAAGTGGCAGG - Intronic
941266182 2:163366064-163366086 AGCCCCAACTTAGATGGGGCAGG + Intergenic
942103925 2:172614059-172614081 CCCATCAACTTGGAAGGGGCAGG - Intergenic
943023560 2:182602260-182602282 TGCCCCAACTCAGAAGGGGCAGG + Intergenic
943345771 2:186735081-186735103 CCCACCAACTCGGTAGGGGCAGG + Intronic
943858296 2:192827923-192827945 CACTCCAACTTGGAAGGTGGCGG - Intergenic
944140306 2:196449032-196449054 CACCCCAACATTGAAGTGGGAGG - Intronic
944292041 2:198018527-198018549 CACTCTAGCTTGGAAGGGGGAGG + Intronic
944539180 2:200740388-200740410 GTCCCCAGCTAGGAAGGGGCAGG - Intergenic
944682090 2:202086282-202086304 CACAGCATCTTGGAAGAGGCTGG + Intronic
947048543 2:226017277-226017299 CACCTGAACTTGGAAGGTGGAGG - Intergenic
947327446 2:228993209-228993231 CCCACCAACTTGGAAGGGGCAGG + Intronic
948575625 2:238947546-238947568 CATCCCAACTTGGAAGAGGTGGG + Intergenic
948761755 2:240196760-240196782 CACCAGAACCTGGAAGAGGCAGG + Intergenic
1169880380 20:10341152-10341174 CCCACCAGCTTGGAAGGGGATGG - Intergenic
1170327740 20:15175849-15175871 CCCATCAACTTGGTAGGGGCTGG - Intronic
1170494860 20:16914922-16914944 CCCACCAACTTGGAAGGAGCAGG - Intergenic
1170552128 20:17487227-17487249 CACCCCATCTTGGGATGGGGAGG - Intergenic
1170612528 20:17926284-17926306 CACCCCAACTCCTGAGGGGCAGG + Intergenic
1170668380 20:18406605-18406627 CACTACAACTTGGAATGTGCTGG - Intronic
1170739985 20:19047677-19047699 TACCCAAACATGGGAGGGGCTGG + Intergenic
1171390053 20:24795473-24795495 CACTCCAACATGGAAGATGCGGG - Intergenic
1171536606 20:25898504-25898526 CATTCCAACTCAGAAGGGGCAGG - Intergenic
1171804499 20:29662653-29662675 CATTCCAACTCAGAAGGGGCAGG + Intergenic
1172346883 20:34209234-34209256 CCCACCAACTTGGAAGGGGTAGG - Intronic
1173082229 20:39879266-39879288 CACCAGAAGCTGGAAGGGGCAGG + Intergenic
1173524557 20:43721753-43721775 CCCGCCAACTTGGAAGGGGTGGG + Intergenic
1173893754 20:46534162-46534184 TGCCCCAACTTGGAGGGGGCAGG - Intergenic
1174138843 20:48398794-48398816 TGCCCCAGCTTGGAAGGGGCAGG + Intergenic
1175001484 20:55633954-55633976 TACCCCAATATGGAAGGGGCAGG + Intergenic
1175064302 20:56272358-56272380 CCCACCAACTCAGAAGGGGCAGG - Intergenic
1175675758 20:60945542-60945564 CACCCCAACTCAGAAGGGATGGG - Intergenic
1176205801 20:63887480-63887502 AACCCCAACTTGGCAGGGATGGG - Intronic
1176790230 21:13311254-13311276 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1177517847 21:22177817-22177839 CACCCAAACGTGCAAGGAGCCGG + Intergenic
1177592220 21:23185402-23185424 CACCACAACTGGGAATGTGCTGG - Intergenic
1177989403 21:28019463-28019485 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1179817878 21:43919440-43919462 CACAGCAACTTGGATGGAGCTGG - Intronic
1180025756 21:45161219-45161241 CCCTCCAACTTGGAAGGGGGTGG - Intronic
1184054528 22:42035451-42035473 CACCCCAACTTGGAAGGGGCGGG + Intronic
1184613493 22:45622016-45622038 CGTCCCAACTCAGAAGGGGCAGG - Intergenic
1184715242 22:46278253-46278275 CACCAGAAATTGGAAGAGGCAGG - Intronic
1184989650 22:48158229-48158251 CACCCCAAGTAGAGAGGGGCTGG + Intergenic
949789859 3:7781276-7781298 CACTACAGCTTGGAAAGGGCAGG - Intergenic
952891896 3:38048612-38048634 CCCCACAGCTTGGAAGGGGGTGG + Intronic
953801906 3:46031093-46031115 CCCACCAACTTCTAAGGGGCAGG - Intergenic
954380255 3:50215468-50215490 CACACCAGCCTGGAATGGGCGGG + Intronic
954417631 3:50401422-50401444 CAGTCCAGCCTGGAAGGGGCAGG + Intronic
954651031 3:52162748-52162770 CACCCCAACTCAGAAGAAGCGGG + Intergenic
955694578 3:61623182-61623204 TACCAAACCTTGGAAGGGGCAGG + Intronic
955865012 3:63372717-63372739 CACCCCAGCTTGGAGGCAGCAGG - Intronic
956222970 3:66923610-66923632 CACCCCAGCTGGGAATGTGCTGG - Intergenic
956462478 3:69485570-69485592 CCCACCAACTTGGAAGGGGTAGG + Intronic
957426912 3:80051283-80051305 CCCACCAACTTGGAAGGGTCAGG - Intergenic
958075961 3:88678905-88678927 CACCCCCACCTGGGAGGAGCAGG - Intergenic
958406178 3:93761019-93761041 CACCCCATCTGGGAAGTGGGGGG - Intergenic
958407019 3:93763950-93763972 CACCCCATCTGGGAAGTGGGGGG - Intergenic
958942430 3:100331172-100331194 AACCCCAACTTGAAAGTGGTTGG + Intergenic
959182797 3:103003745-103003767 CACTCCAACCTGGAAGGTGGAGG - Intergenic
959863818 3:111243452-111243474 CACCCCAACTTGGAAGGGGCAGG + Intronic
960241355 3:115345841-115345863 CACGCCAACTTGGAGGGTGGAGG + Intergenic
960634400 3:119768771-119768793 CACCCCAACTCAGAAGGGGCGGG + Intergenic
961002434 3:123383127-123383149 CACCCCTACCAGGACGGGGCTGG - Intronic
962105405 3:132383680-132383702 CACCCCAACTCAGAAGGGGCAGG + Intergenic
962492480 3:135907881-135907903 CACCCCAAATGTGAAGGGGCAGG - Intergenic
963285361 3:143430018-143430040 AACCTAAACTTGGAATGGGCAGG - Intronic
964582910 3:158260163-158260185 CACCACAGCTTGGAATGTGCGGG + Intronic
965005562 3:163018830-163018852 CTCTCCAACTCAGAAGGGGCAGG - Intergenic
965793248 3:172411544-172411566 CCCACCAACTTGGAAGGGGCAGG + Intergenic
966808791 3:183825704-183825726 CAGCCCCACTTGGCCGGGGCCGG + Intergenic
966877696 3:184332685-184332707 CACAACAACTGGGAAGGGGAGGG + Intronic
967650001 3:191974034-191974056 CACCCCAGCTTGGAAGGGGCGGG + Intergenic
967948554 3:194823083-194823105 CACACCAACATGGAAGGGCCAGG - Intergenic
968538845 4:1151932-1151954 CCACCCAACTCGGAAGGGGCAGG + Intergenic
971056049 4:22913940-22913962 CACCCTAACATGGTAGGGCCTGG - Intergenic
971869504 4:32216688-32216710 TCCTCCAACTTGGAAGGGGGTGG + Intergenic
972158974 4:36199057-36199079 CTTACCAACTCGGAAGGGGCAGG + Intronic
972696111 4:41448294-41448316 CACCCCAAATTGGAGAGGTCTGG + Intronic
972711384 4:41598843-41598865 TACAGCAACTTGGGAGGGGCTGG + Intronic
973672931 4:53238013-53238035 CACCCCATCTTGGAGGGAGGTGG - Intronic
974260421 4:59518524-59518546 CCCGCCAACTTGAAAGGGGCGGG + Intergenic
975910132 4:79258105-79258127 CCCACCAACTTGGAAGGGACAGG - Intronic
976675579 4:87698214-87698236 CCCACCAACTCGGAAGGGGCAGG + Intergenic
976921572 4:90449880-90449902 CCCTCTAACTTGGAAGGGGTGGG + Intronic
977816364 4:101417393-101417415 CCCTCCAACTTGGAACGGGGAGG + Intronic
978471864 4:109077020-109077042 TACCCGAACTTTGAAGGGACTGG + Intronic
980180058 4:129392087-129392109 AGCCCCAGTTTGGAAGGGGCAGG - Intergenic
980682897 4:136187253-136187275 CACCACAACTGGGAATGTGCTGG - Intergenic
980750229 4:137077638-137077660 CACCCCAACTCAGAAGGGGCGGG + Intergenic
982410893 4:155076013-155076035 CACACCAACTTGGATGGAGTTGG - Intergenic
982872196 4:160594660-160594682 CACCTCAACTTGGACGGAGTGGG + Intergenic
983116867 4:163829273-163829295 CACCACATCTTGAAAAGGGCCGG + Intronic
983493112 4:168412147-168412169 CACCACAGCTAGGAAGGTGCTGG - Intronic
985061865 4:186088204-186088226 TCACCCACCTTGGAAGGGGCTGG - Intergenic
985116669 4:186598926-186598948 CACGCCAGCTTTGGAGGGGCGGG - Intronic
985238912 4:187907896-187907918 CTTCTCTACTTGGAAGGGGCAGG + Intergenic
985789717 5:1918991-1919013 CACCAGAACCTGGGAGGGGCAGG - Intergenic
986504037 5:8430384-8430406 CCAGACAACTTGGAAGGGGCAGG + Intergenic
987952055 5:24687792-24687814 CCCTCCAACTTGGAAGGGGGTGG + Intergenic
987999470 5:25330636-25330658 CCCACCAACTTGGAAGGGGAGGG - Intergenic
988940287 5:36139024-36139046 CCCGCCAACTCGGAAGGGGGTGG - Intronic
989279295 5:39622366-39622388 CCCACCAAGTTGGAAGGGACAGG + Intergenic
989339044 5:40354151-40354173 CACTCCAACTTGGAATGGGGCGG - Intergenic
990484714 5:56246775-56246797 CACACACACTGGGAAGGGGCGGG - Intergenic
990639058 5:57761879-57761901 CCCACCAACTTAGAAGGGGCAGG - Intergenic
991283232 5:64939960-64939982 CACCCCAGCTTGGTGGGGGAAGG - Intronic
992795495 5:80252143-80252165 CACTTGAACTTGGAAGGTGCAGG - Intronic
993138346 5:83998500-83998522 CACCACAACTGGGAATGTGCTGG - Intronic
993267447 5:85744308-85744330 CACCACAACTGGGAATGTGCTGG + Intergenic
994245522 5:97471656-97471678 CCCACCAACTTGGAAGGGACAGG + Intergenic
994692486 5:103035163-103035185 CCCTCCAACTTGGAAGGGGGCGG + Intergenic
994851091 5:105056750-105056772 CTCCTCAACTTGGAAGAAGCAGG - Intergenic
995146913 5:108796957-108796979 CACCACAACTGGGAATGTGCTGG + Intronic
995331953 5:110956435-110956457 CCCTCCAACTTGGAAGGGGGTGG - Intergenic
997611759 5:135220536-135220558 CACCTCAACACAGAAGGGGCTGG - Intronic
998291204 5:140916374-140916396 CACCACAACTAGGAATGTGCTGG + Intronic
999217471 5:149947259-149947281 AACCCCAACTTGAAACTGGCTGG + Intergenic
1001479966 5:172081887-172081909 CTCCCCATGTTGGAAGGGGAAGG - Intronic
1001758765 5:174190574-174190596 CACCTCAACTTAGAAGGGAAGGG - Intronic
1002072525 5:176688577-176688599 TACCCCAGCTTGGAAAGGGTGGG + Intergenic
1002773518 6:309132-309154 TACCCCAACTTGTGAGGGGTTGG + Intronic
1004127423 6:12887153-12887175 CTCCCAAACTTGGGAGGGACTGG - Intronic
1006347876 6:33497983-33498005 CCTGCCAATTTGGAAGGGGCAGG - Intergenic
1006405921 6:33844770-33844792 CATTCCTACTGGGAAGGGGCAGG + Intergenic
1006467293 6:34203190-34203212 GCCCCCAACTCAGAAGGGGCGGG + Intergenic
1006500828 6:34457895-34457917 CCCACCAACTCGGAAGGGGCGGG - Intergenic
1006753655 6:36396294-36396316 TGCCCCAACTCAGAAGGGGCTGG - Intronic
1006910811 6:37562437-37562459 CACCCCAGGTTGGGAGGGGTAGG - Intergenic
1007767604 6:44170146-44170168 CATCCAGACTTGGGAGGGGCAGG - Intronic
1008848521 6:55996551-55996573 CACCACAACTTGGAATGTGCTGG + Intergenic
1012169665 6:96002428-96002450 CCTGCCAACTTGGGAGGGGCAGG + Intergenic
1012211390 6:96522194-96522216 CGCCCCACCATGGACGGGGCCGG + Intronic
1012889817 6:104885517-104885539 CCCACCAACTCGGAAGGGGTAGG - Intergenic
1013086850 6:106864311-106864333 CCCACCAACTCGGAAGTGGCAGG + Intergenic
1013692889 6:112667178-112667200 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1013709460 6:112880084-112880106 CCCATCAACTCGGAAGGGGCGGG + Intergenic
1014289193 6:119539332-119539354 CACCCCAATTCAGAAGAGGCAGG - Intergenic
1014770364 6:125452914-125452936 CACTCCAACTTGGGAGGGAGTGG - Intergenic
1015455752 6:133424630-133424652 CCTGCCAACTTGGAAGGGGCGGG + Intronic
1015663567 6:135603011-135603033 TGCCCCAACTCAGAAGGGGCAGG - Intergenic
1016088179 6:139941837-139941859 CACCTCAAACTGGAAGGGTCCGG + Intergenic
1016190569 6:141260636-141260658 CACCCCAACTCGGAAGGAACAGG - Intergenic
1016339764 6:143049852-143049874 TCCACCAACTCGGAAGGGGCAGG + Intergenic
1017054338 6:150424266-150424288 TGCCCCAACTTAGAAGGGGTGGG - Intergenic
1018660034 6:166077109-166077131 CCCACCAACTTGGAGGGGGTGGG + Intergenic
1020568185 7:9823093-9823115 TGCCCCAACTCGGAAGTGGCGGG + Intergenic
1020761113 7:12269324-12269346 CCTGCCAGCTTGGAAGGGGCAGG - Intergenic
1021431263 7:20560736-20560758 CGCTCCAACTAGGAAGGGGTGGG + Intergenic
1021561560 7:21972688-21972710 CCTCCCAACTCAGAAGGGGCAGG + Intergenic
1022279103 7:28888012-28888034 CACAGCAACTTGGATGGAGCTGG - Intergenic
1023897508 7:44446286-44446308 CAGCTCAACTTGGAAGGGAATGG + Intronic
1024024434 7:45399236-45399258 CCCGCCAACTTGGAAGGAGGCGG - Intergenic
1024606179 7:51024391-51024413 CACACCCACTAGGAATGGGCAGG + Intronic
1025288078 7:57685212-57685234 CATTCCAACTCGGAAGGGGCAGG - Intergenic
1026309548 7:69171915-69171937 GAACCCAGCTTGGAAGGGGAGGG - Intergenic
1026614076 7:71886285-71886307 CAGCCCAAGTTGGAATAGGCTGG + Intronic
1026881591 7:73909733-73909755 CCCCCCACGCTGGAAGGGGCTGG - Intergenic
1027842582 7:83331667-83331689 CACCAAAACTTGGAAAGGTCAGG + Intergenic
1028053202 7:86209251-86209273 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1028233178 7:88330009-88330031 CATCCCAATTCAGAAGGGGCAGG - Intergenic
1028801401 7:94969991-94970013 CACCCCAGCTTGGTGGGGGCAGG - Intronic
1029350979 7:100012652-100012674 CCCTCCAACTTGGAAGGAGTGGG - Intergenic
1029424041 7:100485694-100485716 CACCTGACCTTGGAAGGGGCAGG + Intronic
1029899151 7:104021820-104021842 TGCCCCATCTTGGAAGGGGTGGG - Intergenic
1029973930 7:104815172-104815194 CACCCCAACTTAGAAGGGGTGGG + Intronic
1030146075 7:106357384-106357406 AACAGCAACTTGGTAGGGGCAGG + Intergenic
1030699449 7:112622295-112622317 CAGCTCACCTGGGAAGGGGCGGG - Intergenic
1031248524 7:119350133-119350155 CACCTCATCTTGGAAGGGGTGGG - Intergenic
1035021078 7:155800838-155800860 CAGCCCCACCTGGCAGGGGCTGG - Exonic
1035450883 7:158976246-158976268 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1037803686 8:22048384-22048406 GCCCCCAGCTGGGAAGGGGCAGG + Exonic
1037827167 8:22166241-22166263 CACCCCAACTTGGCCTTGGCGGG - Intronic
1038666376 8:29541311-29541333 CTCCCCAACATGGAAGGAGGTGG + Intergenic
1039549545 8:38432911-38432933 CATCCCAACTGGGGAGGGGGGGG - Intronic
1040485731 8:47869582-47869604 CACCACAACTGGGAATGTGCTGG - Intronic
1041357423 8:57014817-57014839 TCCACCAACTTGGAAGGGGTGGG + Intergenic
1041955940 8:63558443-63558465 CCTGCCAACTTGGAAGGGGGTGG - Intergenic
1041965577 8:63670651-63670673 CCCTCCAACTTGGAAGTGGGTGG + Intergenic
1042395927 8:68292392-68292414 CATCCCAACTGAGAAGGGGCGGG - Intergenic
1042608894 8:70576767-70576789 CACTCCAACTTTGAAAGGGATGG - Intronic
1043214932 8:77574051-77574073 CACCACAACTTGAAATGTGCTGG - Intergenic
1043421630 8:80104242-80104264 CCCCCAAACTGGGAAGGAGCTGG - Intronic
1044525104 8:93242277-93242299 CACCCCAACTTGGAATGGGCAGG + Intergenic
1044962247 8:97542698-97542720 CCTGCCAACTTGGAAGGGGTGGG - Intergenic
1046140316 8:110083044-110083066 TCCTCCAACTTGGAAGGGGGCGG - Intergenic
1046407403 8:113791422-113791444 CCCTCCAACTTGGAAGTGGTTGG + Intergenic
1047243271 8:123114402-123114424 CACCTGAACCTGGGAGGGGCAGG - Intronic
1048615139 8:136065995-136066017 CACAGCAACGTGGATGGGGCTGG + Intergenic
1048901432 8:139041662-139041684 CGCCCCAGCTGTGAAGGGGCAGG + Intergenic
1049473047 8:142784729-142784751 GTCCCCACCCTGGAAGGGGCAGG - Intergenic
1049823861 8:144654652-144654674 TGCCCCAACTCAGAAGGGGCGGG - Intergenic
1050130373 9:2406384-2406406 CACCCCAACTTGGAAGGGGCGGG - Intergenic
1050182220 9:2933969-2933991 TGCTCCAAATTGGAAGGGGCGGG - Intergenic
1051001677 9:12290414-12290436 CACCCCAATTCAGAAGGGGTGGG - Intergenic
1053076452 9:35138663-35138685 CATCCCAACTCAGAAGGGGCAGG - Intergenic
1053076517 9:35138953-35138975 CCTGCCAACCTGGAAGGGGCGGG - Intergenic
1053374846 9:37597017-37597039 AACCCCAGCTTGGGAGGGACAGG + Intronic
1053617241 9:39781236-39781258 TACCCCAACTCAGAAGGGGTGGG - Intergenic
1053875423 9:42540601-42540623 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1053897219 9:42754034-42754056 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054236277 9:62561123-62561145 CACCCCAACTCAGAAGGGGTGGG + Intergenic
1054266925 9:62926201-62926223 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1054550418 9:66595655-66595677 TACCCCAACTCAGAAGGGGTGGG + Intergenic
1056740790 9:89253167-89253189 CACAGCAACTTGGAAGGTGCCGG - Intergenic
1056985990 9:91364181-91364203 CACCCCAACTCAGAAGGGGTGGG - Intergenic
1057548363 9:96034682-96034704 CACCCAAACTCAGAAGGGGCAGG - Intergenic
1058091760 9:100813784-100813806 CACCCCAGCTCAGAAGAGGCAGG + Intergenic
1058510585 9:105713069-105713091 CCCACCAACTTGGAAGGGGCAGG - Intronic
1058848390 9:108985875-108985897 CATCTCAACCTGGAAAGGGCTGG + Intronic
1059324468 9:113495876-113495898 CATCCCAACTGGGCCGGGGCTGG + Intronic
1059565391 9:115379480-115379502 CATCCCAATTCAGAAGGGGCAGG - Intronic
1060846853 9:126844305-126844327 CACCCGAAGTTAGAAAGGGCAGG + Intergenic
1061062995 9:128260048-128260070 CAGCCCTTCTTGGATGGGGCGGG + Intronic
1061160709 9:128892393-128892415 CACACCAACTTGCAAGGGCGTGG - Intronic
1186691786 X:11985462-11985484 CACCACAGCTTGGAATGTGCTGG - Intergenic
1187054649 X:15731276-15731298 CACCCCAACAGGGAATGGTCTGG - Intronic
1189083463 X:37997265-37997287 CACACCAATTTGAAAGGGACAGG - Intronic
1189511148 X:41662707-41662729 CACCTGAACTTGGGAGGGGGAGG + Intronic
1189856574 X:45229932-45229954 CACCTCAACTTGGAAGGGGCAGG + Intergenic
1189878454 X:45462786-45462808 CACAGCAACTTGGATGGAGCTGG + Intergenic
1190122355 X:47672524-47672546 CACCACAACTGGGAATGTGCTGG + Intergenic
1190944222 X:55075243-55075265 CATCCCGACCTGGGAGGGGCCGG - Intronic
1192269988 X:69569956-69569978 CAGTTCTACTTGGAAGGGGCAGG + Intergenic
1192366246 X:70476084-70476106 CACCCCAACTTGTCAGTGACTGG + Intronic
1192684333 X:73288044-73288066 GCCACAAACTTGGAAGGGGCTGG + Intergenic
1192761367 X:74098666-74098688 CACCCCATCTGGGAGGGGGTGGG + Intergenic
1193108675 X:77705351-77705373 AGCTCCAACTTGGAAGGGGCAGG + Intronic
1193191043 X:78571951-78571973 CACCCCCACTTGGACTGTGCTGG + Intergenic
1194201696 X:90959211-90959233 CTCCCCAGCTTGGAAGCAGCAGG - Intergenic
1194205221 X:91003295-91003317 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1194380139 X:93181213-93181235 CACCTCAACTCAGAAGGGGCAGG - Intergenic
1195179224 X:102340102-102340124 CACCAGAACTTCGAAGGGGCCGG + Intergenic
1196883773 X:120223876-120223898 CCCACCAACTTGGAAGGGGTGGG + Intergenic
1196883837 X:120224146-120224168 CTCCCCAACCTGGAAGGGGTGGG + Intergenic
1197035526 X:121869950-121869972 CCCACCCACTTGGAAGGGGGTGG - Intergenic
1197747234 X:129939833-129939855 CAGCCCAACATGGCAGGAGCAGG + Intergenic
1198537562 X:137601385-137601407 CACCACAGCTTGGAATGTGCTGG - Intergenic
1199173690 X:144759412-144759434 CACCACAACTAGGATGGTGCTGG - Intergenic
1199614603 X:149647090-149647112 CCCACCAACTCGGAAGGGGCAGG - Intergenic
1199675729 X:150187733-150187755 CAACCCAGCTAGGAAGTGGCAGG + Intergenic
1199861233 X:151801729-151801751 CACTCCAACTCAGAAGGGACAGG + Intergenic
1199969511 X:152849116-152849138 CACCCCAACTGGGAGGGAGGTGG + Intronic
1200547535 Y:4534666-4534688 CTCCCCAGCTTGGAAGCAGCAGG - Intergenic
1200551040 Y:4578432-4578454 CTTCCCAACTCAGAAGGGGCAGG + Intergenic
1200912092 Y:8539703-8539725 CACCACAGCTTGGAGGGGGGGGG - Intergenic
1201552836 Y:15236925-15236947 CACCCCCACGTTGATGGGGCAGG - Intergenic