ID: 1075008312

View in Genome Browser
Species Human (GRCh38)
Location 10:118846281-118846303
Sequence GCTGTCTGTAAAATTCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075008312_1075008315 -3 Left 1075008312 10:118846281-118846303 CCTGATGGAATTTTACAGACAGC No data
Right 1075008315 10:118846301-118846323 AGCAGAAGCTGGGAAGAGAAAGG No data
1075008312_1075008316 23 Left 1075008312 10:118846281-118846303 CCTGATGGAATTTTACAGACAGC No data
Right 1075008316 10:118846327-118846349 CTTAGTGCATACTCATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075008312 Original CRISPR GCTGTCTGTAAAATTCCATC AGG (reversed) Intergenic
No off target data available for this crispr