ID: 1075008972

View in Genome Browser
Species Human (GRCh38)
Location 10:118851985-118852007
Sequence GGTTAGGCTGAGTCCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075008972_1075008975 -10 Left 1075008972 10:118851985-118852007 CCCCTTAGGGACTCAGCCTAACC No data
Right 1075008975 10:118851998-118852020 CAGCCTAACCAGCCCTCTCCAGG No data
1075008972_1075008983 16 Left 1075008972 10:118851985-118852007 CCCCTTAGGGACTCAGCCTAACC No data
Right 1075008983 10:118852024-118852046 ACATGGCCCCGTTCTGGATCAGG No data
1075008972_1075008982 10 Left 1075008972 10:118851985-118852007 CCCCTTAGGGACTCAGCCTAACC No data
Right 1075008982 10:118852018-118852040 AGGCTCACATGGCCCCGTTCTGG No data
1075008972_1075008978 -1 Left 1075008972 10:118851985-118852007 CCCCTTAGGGACTCAGCCTAACC No data
Right 1075008978 10:118852007-118852029 CAGCCCTCTCCAGGCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075008972 Original CRISPR GGTTAGGCTGAGTCCCTAAG GGG (reversed) Intergenic
No off target data available for this crispr