ID: 1075012984

View in Genome Browser
Species Human (GRCh38)
Location 10:118890824-118890846
Sequence TCTCTAGGGTACCCGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075012984_1075012989 14 Left 1075012984 10:118890824-118890846 CCTCACTTCGGGTACCCTAGAGA No data
Right 1075012989 10:118890861-118890883 CCAGAAAAGTGCCACAGAACAGG No data
1075012984_1075012991 26 Left 1075012984 10:118890824-118890846 CCTCACTTCGGGTACCCTAGAGA No data
Right 1075012991 10:118890873-118890895 CACAGAACAGGTTAGTCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075012984 Original CRISPR TCTCTAGGGTACCCGAAGTG AGG (reversed) Intergenic
No off target data available for this crispr