ID: 1075015710

View in Genome Browser
Species Human (GRCh38)
Location 10:118908739-118908761
Sequence TGGACGGGAGCTGGCGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075015704_1075015710 9 Left 1075015704 10:118908707-118908729 CCAGGAGAGGGACTGCGCAGGCA No data
Right 1075015710 10:118908739-118908761 TGGACGGGAGCTGGCGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075015710 Original CRISPR TGGACGGGAGCTGGCGTTTC AGG Intergenic
No off target data available for this crispr