ID: 1075022267

View in Genome Browser
Species Human (GRCh38)
Location 10:118960589-118960611
Sequence GGATAAAATAAAGATGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022267_1075022273 1 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022273 10:118960613-118960635 CACCATGAAGCGGACTGGTTTGG No data
1075022267_1075022276 29 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data
1075022267_1075022269 -4 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022269 10:118960608-118960630 ATCCCCACCATGAAGCGGACTGG No data
1075022267_1075022275 28 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022275 10:118960640-118960662 GTACCCTGCCTGCCTCTTCATGG No data
1075022267_1075022268 -9 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022268 10:118960603-118960625 ATTTTATCCCCACCATGAAGCGG No data
1075022267_1075022277 30 Left 1075022267 10:118960589-118960611 CCTAGAGCATCTTTATTTTATCC No data
Right 1075022277 10:118960642-118960664 ACCCTGCCTGCCTCTTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022267 Original CRISPR GGATAAAATAAAGATGCTCT AGG (reversed) Intergenic
No off target data available for this crispr