ID: 1075022271

View in Genome Browser
Species Human (GRCh38)
Location 10:118960611-118960633
Sequence AAACCAGTCCGCTTCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075022271_1075022275 6 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022275 10:118960640-118960662 GTACCCTGCCTGCCTCTTCATGG No data
1075022271_1075022280 12 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG No data
1075022271_1075022277 8 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022277 10:118960642-118960664 ACCCTGCCTGCCTCTTCATGGGG No data
1075022271_1075022281 13 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022281 10:118960647-118960669 GCCTGCCTCTTCATGGGGCTGGG No data
1075022271_1075022284 18 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022284 10:118960652-118960674 CCTCTTCATGGGGCTGGGTGTGG No data
1075022271_1075022276 7 Left 1075022271 10:118960611-118960633 CCCACCATGAAGCGGACTGGTTT No data
Right 1075022276 10:118960641-118960663 TACCCTGCCTGCCTCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075022271 Original CRISPR AAACCAGTCCGCTTCATGGT GGG (reversed) Intergenic
No off target data available for this crispr